ID: 1136216522

View in Genome Browser
Species Human (GRCh38)
Location 16:28797515-28797537
Sequence GGTCCAATTTATGGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136216513_1136216522 17 Left 1136216513 16:28797475-28797497 CCAGTGCAGATATGTTTTGGTCC No data
Right 1136216522 16:28797515-28797537 GGTCCAATTTATGGAGGAGGAGG No data
1136216517_1136216522 -5 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216522 16:28797515-28797537 GGTCCAATTTATGGAGGAGGAGG No data
1136216516_1136216522 -4 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216522 16:28797515-28797537 GGTCCAATTTATGGAGGAGGAGG No data
1136216518_1136216522 -6 Left 1136216518 16:28797498-28797520 CCAGCAGGATATGTTTTGGTCCA No data
Right 1136216522 16:28797515-28797537 GGTCCAATTTATGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136216522 Original CRISPR GGTCCAATTTATGGAGGAGG AGG Intergenic
No off target data available for this crispr