ID: 1136216523

View in Genome Browser
Species Human (GRCh38)
Location 16:28797518-28797540
Sequence CTTCCTCCTCCTCCATAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136216523_1136216530 5 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216530 16:28797546-28797568 GAGTGAGGAGGAGGCGGAGAAGG No data
1136216523_1136216531 12 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216531 16:28797553-28797575 GAGGAGGCGGAGAAGGAGAGAGG No data
1136216523_1136216528 -4 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216528 16:28797537-28797559 GAAGGAGGAGAGTGAGGAGGAGG No data
1136216523_1136216532 20 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216532 16:28797561-28797583 GGAGAAGGAGAGAGGTCCCAAGG No data
1136216523_1136216526 -10 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216526 16:28797531-28797553 GAGGAGGAAGGAGGAGAGTGAGG No data
1136216523_1136216533 23 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216533 16:28797564-28797586 GAAGGAGAGAGGTCCCAAGGAGG No data
1136216523_1136216529 -1 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216529 16:28797540-28797562 GGAGGAGAGTGAGGAGGAGGCGG No data
1136216523_1136216527 -7 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216527 16:28797534-28797556 GAGGAAGGAGGAGAGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136216523 Original CRISPR CTTCCTCCTCCTCCATAAAT TGG (reversed) Intergenic
No off target data available for this crispr