ID: 1136216527

View in Genome Browser
Species Human (GRCh38)
Location 16:28797534-28797556
Sequence GAGGAAGGAGGAGAGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136216518_1136216527 13 Left 1136216518 16:28797498-28797520 CCAGCAGGATATGTTTTGGTCCA No data
Right 1136216527 16:28797534-28797556 GAGGAAGGAGGAGAGTGAGGAGG No data
1136216517_1136216527 14 Left 1136216517 16:28797497-28797519 CCCAGCAGGATATGTTTTGGTCC No data
Right 1136216527 16:28797534-28797556 GAGGAAGGAGGAGAGTGAGGAGG No data
1136216523_1136216527 -7 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216527 16:28797534-28797556 GAGGAAGGAGGAGAGTGAGGAGG No data
1136216516_1136216527 15 Left 1136216516 16:28797496-28797518 CCCCAGCAGGATATGTTTTGGTC No data
Right 1136216527 16:28797534-28797556 GAGGAAGGAGGAGAGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136216527 Original CRISPR GAGGAAGGAGGAGAGTGAGG AGG Intergenic
No off target data available for this crispr