ID: 1136216531

View in Genome Browser
Species Human (GRCh38)
Location 16:28797553-28797575
Sequence GAGGAGGCGGAGAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136216523_1136216531 12 Left 1136216523 16:28797518-28797540 CCAATTTATGGAGGAGGAGGAAG No data
Right 1136216531 16:28797553-28797575 GAGGAGGCGGAGAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136216531 Original CRISPR GAGGAGGCGGAGAAGGAGAG AGG Intergenic
No off target data available for this crispr