ID: 1136219971

View in Genome Browser
Species Human (GRCh38)
Location 16:28822818-28822840
Sequence CCTTACCCACTCCCAGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136219962_1136219971 14 Left 1136219962 16:28822781-28822803 CCCTAAATCCTTGGCGCGCGTGA No data
Right 1136219971 16:28822818-28822840 CCTTACCCACTCCCAGGGCTAGG No data
1136219963_1136219971 13 Left 1136219963 16:28822782-28822804 CCTAAATCCTTGGCGCGCGTGAG No data
Right 1136219971 16:28822818-28822840 CCTTACCCACTCCCAGGGCTAGG No data
1136219964_1136219971 6 Left 1136219964 16:28822789-28822811 CCTTGGCGCGCGTGAGCGCCCGC No data
Right 1136219971 16:28822818-28822840 CCTTACCCACTCCCAGGGCTAGG No data
1136219961_1136219971 22 Left 1136219961 16:28822773-28822795 CCTTAAGACCCTAAATCCTTGGC No data
Right 1136219971 16:28822818-28822840 CCTTACCCACTCCCAGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136219971 Original CRISPR CCTTACCCACTCCCAGGGCT AGG Intergenic
No off target data available for this crispr