ID: 1136220167

View in Genome Browser
Species Human (GRCh38)
Location 16:28823413-28823435
Sequence AGGCAGGGGGAGGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 764
Summary {0: 1, 1: 2, 2: 5, 3: 59, 4: 697}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136220167_1136220185 14 Left 1136220167 16:28823413-28823435 CCAGCGGCCGCCTCCCCCTGCCT 0: 1
1: 2
2: 5
3: 59
4: 697
Right 1136220185 16:28823450-28823472 CTGCCGGGAGCGGGCTCCGCCGG 0: 1
1: 1
2: 1
3: 15
4: 174
1136220167_1136220186 15 Left 1136220167 16:28823413-28823435 CCAGCGGCCGCCTCCCCCTGCCT 0: 1
1: 2
2: 5
3: 59
4: 697
Right 1136220186 16:28823451-28823473 TGCCGGGAGCGGGCTCCGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 163
1136220167_1136220183 5 Left 1136220167 16:28823413-28823435 CCAGCGGCCGCCTCCCCCTGCCT 0: 1
1: 2
2: 5
3: 59
4: 697
Right 1136220183 16:28823441-28823463 CTGTGGCCGCTGCCGGGAGCGGG 0: 1
1: 0
2: 2
3: 26
4: 357
1136220167_1136220182 4 Left 1136220167 16:28823413-28823435 CCAGCGGCCGCCTCCCCCTGCCT 0: 1
1: 2
2: 5
3: 59
4: 697
Right 1136220182 16:28823440-28823462 CCTGTGGCCGCTGCCGGGAGCGG 0: 1
1: 0
2: 1
3: 16
4: 288
1136220167_1136220189 25 Left 1136220167 16:28823413-28823435 CCAGCGGCCGCCTCCCCCTGCCT 0: 1
1: 2
2: 5
3: 59
4: 697
Right 1136220189 16:28823461-28823483 GGGCTCCGCCGGGGAGCCGAAGG 0: 1
1: 0
2: 2
3: 11
4: 142
1136220167_1136220187 16 Left 1136220167 16:28823413-28823435 CCAGCGGCCGCCTCCCCCTGCCT 0: 1
1: 2
2: 5
3: 59
4: 697
Right 1136220187 16:28823452-28823474 GCCGGGAGCGGGCTCCGCCGGGG 0: 1
1: 1
2: 2
3: 25
4: 272
1136220167_1136220180 -1 Left 1136220167 16:28823413-28823435 CCAGCGGCCGCCTCCCCCTGCCT 0: 1
1: 2
2: 5
3: 59
4: 697
Right 1136220180 16:28823435-28823457 TGGGGCCTGTGGCCGCTGCCGGG 0: 1
1: 0
2: 3
3: 38
4: 413
1136220167_1136220179 -2 Left 1136220167 16:28823413-28823435 CCAGCGGCCGCCTCCCCCTGCCT 0: 1
1: 2
2: 5
3: 59
4: 697
Right 1136220179 16:28823434-28823456 CTGGGGCCTGTGGCCGCTGCCGG 0: 1
1: 0
2: 6
3: 64
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136220167 Original CRISPR AGGCAGGGGGAGGCGGCCGC TGG (reversed) Exonic
900120423 1:1046484-1046506 AGCCAGGGGGAGGGCGCCGGGGG - Exonic
900244514 1:1631093-1631115 AAGCAGCTGGCGGCGGCCGCGGG - Intergenic
900256103 1:1699035-1699057 AGGCTGGGCCAGGCGGCTGCGGG + Intronic
900264771 1:1751645-1751667 AGGCTGGGCCAGGCGGCTGCGGG + Exonic
900342639 1:2195958-2195980 GGGCAGGGGGAGGGGGCCTGGGG + Intronic
900367830 1:2318453-2318475 AGGAGTGGCGAGGCGGCCGCAGG - Intergenic
900428484 1:2591342-2591364 AGGAAGGGGGAGCCTACCGCAGG - Exonic
900564829 1:3327070-3327092 AGGCAAGGCGAGGAGGCCCCAGG + Intronic
900643062 1:3696486-3696508 AGGCAGGGAGAGACAGCGGCTGG + Intronic
900643409 1:3697956-3697978 AGGGAGGGGGAGGCAGTCACGGG - Intronic
900957540 1:5896182-5896204 GGGCAGGGGGAGGAGCCCACAGG + Intronic
901124481 1:6919334-6919356 AGGCAGGAGGATGCTGCCTCTGG + Intronic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
902615348 1:17620637-17620659 AGGCAGGAGGAGGCAGCAGAGGG + Intronic
902711495 1:18243045-18243067 AGGCAGGAGGAGGAGGCTGAGGG + Intronic
903028052 1:20443458-20443480 AGGCAGGGGGATGCAGGCCCTGG - Intergenic
903069419 1:20719419-20719441 AGGGAGGAGGAGGAGGACGCCGG + Intergenic
903071267 1:20728015-20728037 AGGCGGGGGCTGGGGGCCGCAGG - Exonic
903272898 1:22202797-22202819 AGGCTGGGGGTGGCAGCCACAGG - Intergenic
903369644 1:22826947-22826969 AGGCAGGGGGAGGGGACTGTGGG - Intronic
903622022 1:24704778-24704800 AGACGGGGGGAGGCGGCGGGAGG - Intergenic
903724662 1:25431385-25431407 GGGCAGGGCGCGGCGGGCGCTGG + Intronic
903777899 1:25805027-25805049 AGGCAGGGGGTGGGGGTAGCTGG - Intronic
903902620 1:26659082-26659104 GGGCAGGGGGAGGCTGAGGCAGG + Intergenic
904383887 1:30129402-30129424 AGGCAGGGGGTGGAGGAGGCGGG + Intergenic
904464647 1:30700608-30700630 AGGCAGGGGGTGGAGACAGCAGG + Intergenic
904471962 1:30741601-30741623 AGGAAGGGGCAGGGGGCAGCGGG + Intronic
905684803 1:39900995-39901017 GGACAGGGGGCGGCGGGCGCCGG + Exonic
906520898 1:46466455-46466477 AGGCCGGGCGATGCGGCCGCGGG + Intergenic
906524356 1:46485777-46485799 TGGGAGGTGGAGGGGGCCGCGGG + Intergenic
906797372 1:48708808-48708830 AGGCAGAGGGAGGTGGCCAGTGG - Intronic
907443125 1:54490543-54490565 AGGGAGGGAGGGGCGGCTGCAGG - Intergenic
910243665 1:85115696-85115718 TGGCAGGGGGAGGTGGGGGCAGG + Intronic
912335653 1:108859944-108859966 AGGCAGGGGGAGGAGGGCGGAGG - Intronic
912514779 1:110210792-110210814 GCGCAGGGCGAGGCGGCAGCTGG - Intergenic
913112794 1:115671350-115671372 AGCCAGGGAAAGGAGGCCGCAGG - Intronic
913681091 1:121187226-121187248 AGGCCGGGTGCGGCGGCGGCTGG - Exonic
913975083 1:143449635-143449657 ACGCAGGGGAAGCCGGCCGGAGG + Intergenic
914032921 1:143974866-143974888 AGGCCGGGTGCGGCGGCGGCTGG - Intergenic
914069475 1:144275251-144275273 ACGCAGGGGAAGCCGGCCGGAGG + Intergenic
914109680 1:144691103-144691125 ACGCAGGGGAAGCCGGCCGGAGG - Intergenic
914156525 1:145093100-145093122 AGGCCGGGTGCGGCGGCGGCTGG + Exonic
915461079 1:156070855-156070877 GGGCAAGGGGAGGAGGCAGCGGG + Intergenic
915549895 1:156625656-156625678 GGGGAGGGTGAGGCGGCCGGGGG + Exonic
916491577 1:165306885-165306907 GGGCAGGGGGAGGCGGAGGAGGG - Intronic
916717270 1:167456006-167456028 AGGAAGGGGGAGGGGGCGGGGGG - Intronic
917515140 1:175700905-175700927 AGGCTCGGGGAGGCGGACGAAGG - Intronic
917869645 1:179229774-179229796 CGGCAGGGCGGGGCGGCAGCCGG - Intergenic
918332440 1:183472673-183472695 ACGTAGGGGGAGCGGGCCGCAGG + Intronic
919829617 1:201531390-201531412 AGGCCCGGGCAGGCGGCCGTGGG - Intergenic
920260474 1:204685068-204685090 TGGGAGAGGGAGGCGGCCGAGGG - Intronic
920694327 1:208170411-208170433 AGGCAGGGGGAAGCAGGGGCGGG + Intronic
920740404 1:208576587-208576609 AGAGAGGAGGAGGCGGCAGCAGG - Intergenic
921051990 1:211517411-211517433 AGGCATGGGGAAGTGGCAGCAGG - Intergenic
921058374 1:211561906-211561928 AGGCAAGGGGAGGCTGAGGCAGG + Intergenic
921334482 1:214072637-214072659 AGGCAGAGGGAGGCAGCAGGGGG - Intergenic
922597550 1:226825623-226825645 AGGCAGGGGCAGGGCGCCGGGGG - Intergenic
922669104 1:227495232-227495254 AGGCTGGGGGAGGTGGGCGCGGG - Intergenic
922670493 1:227506070-227506092 AGGCTGGGGGAGGTGGGCGCGGG + Intergenic
922961270 1:229647594-229647616 CGGCAGGGGGAGGAGGCCATCGG + Exonic
922988322 1:229884070-229884092 AGGCTGGGGGTGGCGGCAGCAGG - Intergenic
923148673 1:231215328-231215350 AGGGTGGGAGAGGCTGCCGCAGG - Intronic
923506524 1:234609938-234609960 AGGGGGCGGGGGGCGGCCGCCGG + Intergenic
924242796 1:242056966-242056988 AGGCTGGGGGAGGTGGGCGCGGG + Intergenic
924606663 1:245541248-245541270 AGGCAGGGGCAGGAGACCGAGGG + Intronic
924797117 1:247300487-247300509 AGCCAGGGTGAGGCCGCCCCAGG + Exonic
1062764353 10:49331-49353 AGGCGGAGGGAGGTGGGCGCGGG - Exonic
1062782317 10:225441-225463 AGGCAGGAGGAGGCTGGCCCAGG - Intronic
1062887824 10:1032484-1032506 AGGCAGGGGGAGGGGGCTGAGGG - Intergenic
1063386695 10:5620395-5620417 AGGAAGGAGGAGGGAGCCGCTGG + Intergenic
1064913305 10:20427310-20427332 AAGCAGTGGGAGGAGGCTGCAGG + Intergenic
1065069084 10:22003595-22003617 AGGCGGCGGGAGCCGGCTGCCGG + Exonic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065373877 10:25016990-25017012 CAGCAGGCGGAGGAGGCCGCGGG - Intronic
1065916497 10:30358155-30358177 AGGCAGGGAGAGCAGGCAGCTGG - Intronic
1066295145 10:34047600-34047622 TGGCAGGAGAAGGCGGCTGCGGG + Intergenic
1067069074 10:43119450-43119472 AGCCAGGGGTGGGAGGCCGCAGG - Intronic
1067139902 10:43648466-43648488 TGGGAGGGGGAGGCCGCGGCAGG - Intronic
1067690514 10:48498536-48498558 GGGCAGAGGGAGGCTGCAGCGGG - Intronic
1068696288 10:59971250-59971272 AGGAAGGAGGAGGCGGCAGATGG - Intergenic
1068788439 10:61001696-61001718 GGGCGGGGGGAGGCGGCCCAGGG - Intergenic
1070610152 10:77927056-77927078 GGGGAGCGGGTGGCGGCCGCGGG - Intergenic
1070688022 10:78504307-78504329 GGGCTGGGGGAGGAGGCTGCAGG - Intergenic
1072549093 10:96463618-96463640 AGGCAGGGGGAGGGGGACACTGG + Intronic
1072723076 10:97792649-97792671 AGGCTGGGAGAGGCAGCAGCTGG + Intergenic
1072891536 10:99329490-99329512 AGCCAGGCGGCGGCGGCCGGGGG - Exonic
1073124729 10:101142112-101142134 GGGCAGGCAGTGGCGGCCGCTGG - Intergenic
1073136734 10:101224529-101224551 GGGCTGGGGGCGGCGGCCCCAGG - Intergenic
1073143211 10:101262381-101262403 AGGCTGCGGGAGGCGGCTGGGGG - Intergenic
1073248289 10:102106839-102106861 AGGAAGGAGGAGGAGGCAGCCGG - Intergenic
1073249858 10:102114776-102114798 AGGCAGCAAGAGGCGGCGGCGGG - Intronic
1074772465 10:116742687-116742709 AGGTCGGGGAAGGCGGGCGCGGG + Intergenic
1074938962 10:118216204-118216226 AGTCAGGGGGAGGAGGGGGCAGG - Intergenic
1075519752 10:123136424-123136446 AGGTCGCGGGAGGTGGCCGCCGG - Exonic
1076410449 10:130245235-130245257 AGGCAGCGGGAGGCTGCTGCGGG + Intergenic
1076442699 10:130491277-130491299 AGGCAGCAGGAGGAGGCCCCTGG - Intergenic
1076527281 10:131120022-131120044 AGGCAGGGAGGGGCGGACCCTGG - Intronic
1076670549 10:132118495-132118517 AGGCAGAGGGAGGCTGCCCCAGG - Intronic
1076674327 10:132140371-132140393 GGGCAGCGGGAGGAGGCGGCGGG + Intronic
1076707212 10:132308361-132308383 AGGCAGGGGAGGGAGGCCCCCGG - Intronic
1076855376 10:133113350-133113372 AGGCAGGTGAAGGCGGGAGCAGG - Intronic
1076993734 11:288806-288828 ACCCAGGTGGAGGCGGCCGGGGG + Intergenic
1077060484 11:615768-615790 AGGGAGGCGGAGGCGGAGGCGGG - Intronic
1077093496 11:789871-789893 CGGGAGAGGGAGGCGGCGGCCGG - Intronic
1077173402 11:1178321-1178343 GGGTGGGAGGAGGCGGCCGCAGG + Intronic
1077194185 11:1271044-1271066 AGGCAGAGGGAGCCGGCCTGGGG + Intergenic
1077200845 11:1306785-1306807 AGGCAGGAGCTGGAGGCCGCCGG - Intronic
1077233545 11:1469219-1469241 AGGCAGGGGGCTGAGGCAGCTGG + Intergenic
1077281775 11:1749268-1749290 TGGCAGGAGGAGGCGGAGGCGGG - Intronic
1077307037 11:1873083-1873105 AGGCAGGGAGAGGTGGAGGCAGG + Intronic
1077361087 11:2140400-2140422 AGCCAAGGGGAAGGGGCCGCCGG + Intronic
1077370356 11:2178966-2178988 AGCCAGGGGGAGGGGGCAGAGGG - Intergenic
1079083860 11:17431563-17431585 AGGCTGGGTGAGGGGGCTGCAGG + Intronic
1079087131 11:17454518-17454540 AGGCAGAGGGAGGAGGTCGAAGG + Intronic
1080283462 11:30584731-30584753 AGGGAGGAGGCGGCGGCCCCGGG - Intronic
1080283757 11:30585987-30586009 GGGGAGGGGGAGGAGGCGGCCGG - Intronic
1080643894 11:34174430-34174452 AAGCAGGGAAAGGCGGCGGCAGG + Intronic
1081805051 11:45885866-45885888 AGGAACGGGGAGGCGGCGGGCGG - Exonic
1081808599 11:45903069-45903091 AGGCAGGGGGCTGGGGCCGCGGG - Exonic
1083096106 11:60253382-60253404 AGGCAGGGGGAGGAGGAGACAGG - Intergenic
1083797742 11:65027441-65027463 AGGCCTGGCGAGGCGGCGGCGGG + Exonic
1084008935 11:66337160-66337182 GGGGAGGGGGAGGTGGGCGCTGG - Intergenic
1084263241 11:67991886-67991908 GTGCGGGGCGAGGCGGCCGCGGG - Intronic
1084370394 11:68738273-68738295 AGGCAGCGGGCGGAGGCAGCTGG + Intronic
1084400260 11:68939265-68939287 AGGCAGTGGGAAGTGGCCGCAGG + Intronic
1084599648 11:70137336-70137358 AGGCAGGGGCAGGCAGGGGCAGG - Intronic
1084599652 11:70137346-70137368 AGGCAGGGGCAGGCAGGGGCAGG - Intronic
1084621037 11:70270565-70270587 AGGGGGCGGGAGGCGGCCCCGGG - Intergenic
1085299542 11:75450181-75450203 AGGCAGGAGGAGGCAGCAGGAGG + Intronic
1085445688 11:76599274-76599296 CAGCTGGGGGAGGGGGCCGCAGG - Intergenic
1085745394 11:79110529-79110551 TGGCAGGGAGAGGAGGCAGCTGG - Intronic
1085777881 11:79382670-79382692 AGGGAGGGGGAGGAGGACACTGG + Intronic
1086455489 11:86955560-86955582 AGGGAGGGAGGGGCGGCCGGAGG - Intergenic
1087146891 11:94821669-94821691 TGGCTGGGGGAGGCGGCAGGCGG - Exonic
1087560621 11:99785047-99785069 AGGCAGGTGGAGGCAGGCGGAGG - Intronic
1089496079 11:118909355-118909377 GGGGAGGGGGAGGCGGCGGGGGG - Intronic
1089630802 11:119783039-119783061 AGGCAGGGGCAGGTGGCCCTGGG + Intergenic
1089757708 11:120698650-120698672 AGCCAGGGGGAAGGGGCAGCAGG - Intronic
1091259908 11:134225490-134225512 ACGCAGGGGGAGTCGCCCACGGG - Intronic
1091445475 12:542344-542366 AGGCAGGGAGAGGAGGGGGCAGG - Intronic
1091799901 12:3318328-3318350 AGGCAGCGGGAGGCGGACATGGG - Intergenic
1092108915 12:5945330-5945352 GGGGAGGAGGAGGCGGCAGCCGG - Intronic
1092162620 12:6324296-6324318 AGGCTGGAGGAGGCGGCGGGGGG - Intronic
1092253228 12:6913046-6913068 AGGCAGTGGGAGGAGGCCAAGGG + Intronic
1092462334 12:8697828-8697850 GGGCGGGGGGCGGCGGCCGGAGG - Intronic
1093097281 12:14985666-14985688 AGGCAGGTGGAGGCAGGAGCTGG + Intergenic
1094496782 12:30993826-30993848 TGCCAGGGGGAGGCGGCAGTGGG + Exonic
1094498786 12:31005635-31005657 AGGCAGGGGTGGGTGGGCGCAGG + Intergenic
1096549067 12:52360411-52360433 AGCCAGGAGGAGGGGGCTGCTGG + Exonic
1097046250 12:56189528-56189550 AGGCGGCGGGAGGCGGGCGGAGG - Exonic
1097222845 12:57460920-57460942 GGGCAGCGGGAGCCAGCCGCAGG + Intronic
1097891445 12:64781098-64781120 AGGCGGCGGGCGGGGGCCGCGGG + Intergenic
1098105737 12:67068493-67068515 AGGCAAGGGGGCGCTGCCGCAGG - Intergenic
1098394427 12:70003114-70003136 AGGCAGGAGGAGGCAGCAGGAGG + Intergenic
1100433936 12:94554487-94554509 AGGCATGGGGAGGAGGACACAGG + Intergenic
1100619411 12:96256812-96256834 AGGCAAGAGGAGGAGGCAGCGGG + Intronic
1101032123 12:100671064-100671086 AAGCAGGGGGAGGAGGTGGCAGG + Intergenic
1101466737 12:104957791-104957813 AGGCAGGGACAGGCGGCGGGTGG - Intronic
1101493959 12:105236156-105236178 GGGCAGGCGGCGGCGGCCACTGG - Intronic
1101880935 12:108625183-108625205 GGGCAGGGAGAGGGGGCAGCAGG - Intronic
1102192492 12:110999179-110999201 AGGCGAGGGGAGGCAGCCACTGG - Intergenic
1102645832 12:114403281-114403303 AGGCAGGAGGAGGCGGGAGGAGG + Intronic
1103052523 12:117792628-117792650 AGGCAGAGGGCAGGGGCCGCGGG - Intronic
1103377556 12:120469069-120469091 CCGTAGGGGGAAGCGGCCGCGGG - Intronic
1103716824 12:122949975-122949997 CGGCAGCGGGAGGGGGCAGCCGG - Intronic
1103741652 12:123095499-123095521 AGGCGGGGGGAGGAGGGGGCAGG - Intronic
1103800315 12:123533620-123533642 GGGCAGCGGGCGGCGGGCGCGGG + Exonic
1103910596 12:124349957-124349979 AGGCCTGGGGAGGGGGCTGCGGG + Intronic
1104092263 12:125526793-125526815 TGGCAGAGGGAGGCGGCTGTGGG + Intronic
1104549129 12:129739750-129739772 AGGCAGTGGGAGGCGCTGGCAGG + Intronic
1104843147 12:131834220-131834242 AGCCAGGGGGTGGCTGCCGTGGG + Intronic
1104916691 12:132269187-132269209 AGGCAGGGGGAGGCGTCGGGAGG + Intronic
1105209749 13:18250655-18250677 GGGCAGGAGGAGGCGTCCACAGG - Intergenic
1105472133 13:20703886-20703908 GGGCGAGGGGAGGCGCCCGCCGG + Intronic
1106220775 13:27744590-27744612 AGGCATGGGGAGCCAGCAGCCGG - Intergenic
1108003270 13:45923857-45923879 AGGCAGGGCCAGGCGGTGGCCGG - Intergenic
1108029250 13:46211860-46211882 AGGCGAGGCGAGGCGGGCGCCGG - Intronic
1108541803 13:51452737-51452759 AGGCAGGAGGAGGCGGAGGCGGG - Exonic
1110617168 13:77554117-77554139 AGGCAGGGGGAGGCCAGCGAAGG + Intronic
1112091745 13:96090647-96090669 CGGGCGGGGGAGGCGGGCGCCGG - Intergenic
1113371346 13:109728219-109728241 GCGCAGAGGGAGGCGGACGCAGG + Intergenic
1113708819 13:112451041-112451063 AGGCAGAGTTAGGCGGCCCCGGG - Intergenic
1113909530 13:113835686-113835708 GGGCTGGGGCAGGCGGCTGCAGG + Intronic
1114491654 14:23106184-23106206 AGGCCGGGGGAGGCGGGGGGAGG - Intergenic
1114559296 14:23578896-23578918 AGGCAGGGGGAGGCCGAAGCCGG + Intergenic
1114612384 14:24051571-24051593 AGGCAGGGCGAGTCGGGCGAGGG + Intergenic
1116886951 14:50231371-50231393 GGGCGGGAGGCGGCGGCCGCCGG - Exonic
1117211885 14:53509328-53509350 AGGAAGGGGGATGTGGCTGCAGG + Intergenic
1117424496 14:55580457-55580479 GGGCGGGGGGGCGCGGCCGCGGG + Intronic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1117920614 14:60723030-60723052 AGGTAGGGGGCGGCGGAGGCGGG - Intronic
1118325124 14:64775243-64775265 AGGCTGCGGGAGGCAGCGGCCGG - Exonic
1118693832 14:68364518-68364540 GGGCTGGGGGAGGGGGCTGCTGG - Intronic
1119780114 14:77271505-77271527 AGGCCTGGGGAGGCGGCCTAGGG + Intergenic
1120881296 14:89417011-89417033 GGGCGGCGGGGGGCGGCCGCGGG + Intronic
1120904666 14:89609890-89609912 AGGGCGGGGGCGGCGGCGGCTGG + Intronic
1121087075 14:91154908-91154930 AGGCAGGAGGTGGCGGGAGCTGG - Intronic
1121599867 14:95195398-95195420 AGGCAGGGGGAGGAGGGCCAAGG - Intronic
1121737914 14:96231491-96231513 AGGCAGGGGGTGGCGGAAGGGGG - Intronic
1122075821 14:99233875-99233897 AGGCAGGGGAGGGGGGCAGCCGG + Intronic
1122126145 14:99579694-99579716 AGGCAGCGGGAGGCAGGGGCAGG + Intronic
1122298705 14:100719798-100719820 GGGCAGGGGCAGGTGGCAGCAGG + Intergenic
1122337579 14:101004144-101004166 AGGCAGAAGGAGGAGGCAGCTGG - Intergenic
1122529825 14:102417899-102417921 AGCCACGGGGAGGCTGCTGCAGG + Intronic
1122543295 14:102509481-102509503 GAGGAGGGGGCGGCGGCCGCGGG + Intronic
1122558078 14:102592243-102592265 AGGCTGCGGGAGGCGTGCGCGGG + Intergenic
1122690315 14:103529139-103529161 GGGGAGGGGGAGGCGGAGGCGGG + Intergenic
1122788774 14:104175771-104175793 AGGCGGGGGCAGGTGGCCCCAGG - Exonic
1122879398 14:104683319-104683341 AGGCAGGGAGTGGCAGCCCCAGG - Intergenic
1123787446 15:23687338-23687360 GGGCAGGGCGGGGCGGCGGCGGG + Intergenic
1124370745 15:29103540-29103562 AGTGACGGGGAGGCGGCGGCTGG + Intronic
1125536112 15:40441751-40441773 AGGCAAGGGGCCGCGGCCGGGGG + Intronic
1126196589 15:45938251-45938273 AGGCAGGGGTCAGCGGCTGCAGG + Intergenic
1126486535 15:49187692-49187714 AGGCTGGGGGAGGTGGCTACAGG - Intronic
1127054017 15:55113569-55113591 AGGGAGGGGGAGGCAGCAGGGGG - Intergenic
1127488178 15:59438213-59438235 CGGCTGGGTGCGGCGGCCGCTGG - Exonic
1128119257 15:65133615-65133637 AGGAAGGGGGCGGAGGCCCCCGG + Exonic
1128511844 15:68318370-68318392 AAGCAGGGGAAGGCGGATGCTGG + Intronic
1128582072 15:68817812-68817834 AGGCAGGGGGAGCCGGCTTTGGG - Intronic
1128800160 15:70492183-70492205 AGGTAAGGGGAGGGGGCCCCTGG + Intergenic
1128866017 15:71115652-71115674 AGGCGAGGCGAGGCGGCCGCCGG + Intronic
1129699209 15:77757903-77757925 AGGCAGGGAAAGGCGGCCCACGG - Intronic
1130094228 15:80844230-80844252 AGGCAGGGGGAGGGCGCGACAGG - Intronic
1131367618 15:91853572-91853594 TGGCAGCGGCGGGCGGCCGCGGG + Intergenic
1131431733 15:92393831-92393853 AGGGAGGGGCAGGCGGGAGCCGG + Exonic
1131536176 15:93239868-93239890 AGGCAGGGGGAGGCAGGCCAGGG - Intergenic
1131640053 15:94283025-94283047 AGGCAGTGGGAGGAGGCTGTGGG + Intronic
1131692813 15:94845083-94845105 AAGCAGCGGGCGGCGGCGGCGGG - Intergenic
1132054806 15:98642583-98642605 AGGCAGGGGGAAGTGGTCACAGG - Intergenic
1132279687 15:100602422-100602444 AGGCAGAGGGTGGGGGCTGCCGG + Intronic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1132525085 16:410491-410513 CGTCAGGGGGAGGCCCCCGCTGG - Intronic
1132544676 16:527796-527818 AGGCAGCGTAAGGCGGGCGCCGG + Intronic
1132650943 16:1021235-1021257 AGGCCAGGGGAGGCGGGTGCAGG - Intergenic
1132809885 16:1792414-1792436 AGGCTTGGGGAGGCGGCCCGAGG + Exonic
1132849050 16:2016022-2016044 AGGCACGGGGAGGCGTCTGTTGG - Intronic
1132933945 16:2471771-2471793 TGGCAGGGGTCGGCGGGCGCCGG - Exonic
1133027595 16:2995467-2995489 AGGCAGGGAGAGGACGCCCCAGG - Intergenic
1133051601 16:3120269-3120291 ATGCTGGGGGCGGCGGCGGCGGG + Exonic
1133097637 16:3458185-3458207 AGGTGGCGGGGGGCGGCCGCCGG + Intronic
1133219958 16:4315760-4315782 AGGGAGGGCGGCGCGGCCGCGGG - Intronic
1133740412 16:8647011-8647033 AGGCAGGGGAAAGGGGCTGCAGG - Exonic
1134149861 16:11797155-11797177 AGGCAGGCGGAGGCGGGCGGCGG + Intronic
1135920767 16:26647084-26647106 AGGCGGGGGGTGGGGGTCGCTGG - Intergenic
1135970846 16:27070892-27070914 AGGCAGGGGGAGGAGGACTCAGG - Intergenic
1136114708 16:28087393-28087415 AGGCAGGGGGTGGGCGCAGCAGG + Intergenic
1136220167 16:28823413-28823435 AGGCAGGGGGAGGCGGCCGCTGG - Exonic
1136292683 16:29285329-29285351 GGGCAGGGGGATGGGGGCGCCGG - Intergenic
1136367164 16:29814171-29814193 GGGCAGGGGGAGGAGGGCACAGG - Intronic
1136396240 16:29994005-29994027 AGGCAGGGGGAGGCCCCCAGGGG - Exonic
1136550640 16:30980669-30980691 TGGCAGGAGGACGCGGCGGCGGG - Intronic
1136778872 16:32885197-32885219 CTGCTGGGGGAGGGGGCCGCGGG + Intergenic
1136891746 16:33976321-33976343 CTGCTGGGGGAGGGGGCCGCGGG - Intergenic
1137270604 16:46900247-46900269 ATGCAGGGGGAGGGGGCCTAGGG + Intronic
1138360579 16:56424879-56424901 GGGGAGGGGGAGGGGGCCGCGGG - Intronic
1138553469 16:57759373-57759395 AGGCACAGGGAGGGGGCTGCAGG + Intronic
1139709005 16:68761958-68761980 TGGCAGGAGGAGGCAGCCGGTGG - Intronic
1141140637 16:81494622-81494644 AGGCATCGGGGGGCGGCCCCGGG - Intronic
1141425230 16:83940505-83940527 AGGCAGGTGGAGGTGGCCAGAGG + Intronic
1141432416 16:83977299-83977321 AGGAGGGGGGAGGTGGCTGCAGG + Intronic
1141538641 16:84700453-84700475 CGGCCGGGGGAGGCGGCCCGGGG + Intronic
1141606061 16:85154074-85154096 AGGCAGGAGGAGGGGGGCGGTGG - Intergenic
1141608501 16:85169023-85169045 ACGCGGGGGGAGGCGGCGGCGGG + Intergenic
1141683158 16:85555666-85555688 AGGAAGGGGGGGGCGGCGGGAGG - Intergenic
1141692964 16:85606894-85606916 AGGCAGGGGAAGGGGGCTGGGGG - Intergenic
1141884501 16:86882469-86882491 AGGCAGTGGGGGGCGGCTGTGGG + Intergenic
1142009874 16:87708509-87708531 AGGCAGGTGGGGGAGGCTGCGGG + Intronic
1142045033 16:87919792-87919814 AGGCAGGGGGCAGCGGCGGGTGG + Intronic
1142127972 16:88419596-88419618 AGGGAGTGGGAGGCTGCCGGGGG - Intergenic
1142177956 16:88653521-88653543 AGGGAGGGGGAGACGGCAGGTGG + Intronic
1142213392 16:88819192-88819214 AGGCTGGGGCAGGTGGCCGGGGG - Intronic
1142440293 16:90093908-90093930 AGGCTGAGGGAGGTGGGCGCGGG + Intergenic
1203081286 16_KI270728v1_random:1147286-1147308 CTGCTGGGGGAGGGGGCCGCGGG + Intergenic
1142478749 17:205198-205220 AGGCAGGAGGAGGAGGAGGCAGG - Intergenic
1142711107 17:1724602-1724624 AGGGAGGGCGGGGAGGCCGCCGG + Intronic
1142864935 17:2785039-2785061 AGGCAGGGGGATGATGCCGCAGG - Intronic
1142974836 17:3637014-3637036 AGGCAGGGGCAGCGGGCTGCCGG + Intronic
1143090814 17:4448233-4448255 ACACAGGGGGAGGGGGCCGTGGG + Exonic
1143094238 17:4468565-4468587 GGGCAGGGGGCGGTGGCGGCGGG + Intronic
1143492930 17:7294475-7294497 AGCGAGGTGGAGGCGGCAGCGGG - Exonic
1143591521 17:7888095-7888117 GGCCAGGGGGAGCCGGCTGCTGG + Intronic
1143681886 17:8481898-8481920 AGGCAGGTGGGGGCCTCCGCAGG + Intronic
1144219355 17:13086103-13086125 AGGCACGGGGAGGGGGCAGGAGG - Intergenic
1144576276 17:16431861-16431883 GGGAAGGGGGAGGGGGCCGGAGG - Intronic
1144764457 17:17725051-17725073 GGGCAGGGGGAGGGGGCTCCTGG + Intronic
1144822956 17:18088238-18088260 AGGCAGGGCCAGGCGGGAGCGGG + Intronic
1145741611 17:27279562-27279584 AGGCAGGGGGAGGTTGAGGCAGG + Intergenic
1145769209 17:27480194-27480216 AGGCAAGGGGAGGAGGCCTGGGG - Intronic
1146095913 17:29930112-29930134 GGGGAGGAGGAGGAGGCCGCGGG + Exonic
1146911928 17:36653810-36653832 GGGCAGGGGCTGGCGGCCCCTGG + Intergenic
1146938163 17:36825574-36825596 AGGCCGGGGCAGGAGGCCGCTGG - Intergenic
1147137634 17:38443429-38443451 TGGCAGGGGGAGGCGGGAGGAGG + Intronic
1147149968 17:38509027-38509049 AGGCAGGGGAAGGCAGGGGCGGG + Intronic
1147793079 17:43025280-43025302 GGGGCGGGGGAGGCGGCGGCGGG + Exonic
1147947098 17:44086481-44086503 TGGCAGGGGGAAGAGGCTGCTGG - Intronic
1147950712 17:44106198-44106220 AGGCAGGGGGAGGGGGACACAGG + Intronic
1147970851 17:44218745-44218767 AGGCGGGGGGAACCGGCCGGGGG - Intronic
1148088772 17:45010091-45010113 AGGCTGGGGGAGGAGGAAGCAGG + Intergenic
1148262091 17:46193020-46193042 GGGGAGGGGAAGGCGGCGGCGGG + Intronic
1148437279 17:47694267-47694289 GGGCAGGAGGAGGCGGCAGGAGG + Intronic
1148440258 17:47708526-47708548 GGGCAGGGGGAGGCAGCCGCGGG + Intronic
1151442984 17:74145651-74145673 CGGCAGGGGGTGGTGGGCGCGGG - Intergenic
1151946027 17:77320369-77320391 GGGCAGTGGGGGGCGGCCGATGG - Intronic
1152214381 17:79024049-79024071 GGCCGGGAGGAGGCGGCCGCTGG + Intronic
1152220751 17:79064035-79064057 AGGCAGGAGGAGGCTGCAGTGGG + Intergenic
1152354017 17:79798043-79798065 GGGCAGGGGCAGGTGGCTGCGGG - Intronic
1152395565 17:80030777-80030799 AGGCAGGGTGTGGGGGCCACGGG + Intronic
1152581692 17:81168126-81168148 AGGCAGGGGGAGGTGGCCAGTGG + Intergenic
1152596905 17:81242219-81242241 AGGCAGGGGTGGGGGGCAGCCGG - Intergenic
1152606588 17:81294697-81294719 GGGCGGGTGCAGGCGGCCGCGGG - Intronic
1152608426 17:81304270-81304292 AGGTTGGGCGAGGCGGCCGCAGG + Intergenic
1152632062 17:81414788-81414810 AGGCTGGGGGCGGAGGCGGCAGG + Intronic
1152811853 17:82386117-82386139 AGGCCGGGGAAGGCGGAGGCAGG - Intergenic
1152957261 18:49650-49672 AGGCTGAGGGAGGTGGACGCGGG - Exonic
1154231382 18:12559124-12559146 GAGCAGGGGGAGGCGCCCCCTGG + Intronic
1154351117 18:13584127-13584149 AGGCAGGCAGAGGCAGACGCCGG - Intronic
1154356414 18:13625681-13625703 TGGCGGGGGGAGGAGGGCGCCGG - Intronic
1154356424 18:13625701-13625723 TGGCAGGGGGAGGAGGCCTCTGG - Intronic
1154356440 18:13625741-13625763 TGGCAGGGGGAGGAGGGCTCTGG - Intronic
1154356466 18:13625802-13625824 TGGCGGGGGGAGGAGGGCGCCGG - Intronic
1157354037 18:46917229-46917251 AGGCACGAGCAGGCGGCGGCCGG + Intronic
1157389210 18:47287351-47287373 TGGCTTGGGGAGGCGGCCTCAGG - Intergenic
1157589264 18:48826491-48826513 AGGCAGGGTGAGGAGGCGGTGGG - Intronic
1157613906 18:48975867-48975889 AGGCAGGGGGAAGGGGCGGGCGG + Intergenic
1159910161 18:74138364-74138386 AGGCGGGGGGAGGAGGCAGCAGG - Intronic
1160619458 18:80160547-80160569 GTGCAGGCGGAGGCGGGCGCTGG - Exonic
1160659277 19:290913-290935 CGGGAGGTGGGGGCGGCCGCGGG - Intronic
1160724758 19:613183-613205 AGGCAGGGCGAGGGGGAAGCGGG + Intronic
1160810965 19:1012790-1012812 AGCCAGGGAGAGGGGGCCACGGG - Intronic
1160853470 19:1205811-1205833 CGGAAGGGGGAGGCGGCCCGGGG + Intronic
1160857905 19:1225705-1225727 AGTCAGTGGGAGGCCGCCCCGGG - Intronic
1160861247 19:1238019-1238041 AGGGAAGGGGAGGCGGTGGCCGG - Exonic
1160882056 19:1325367-1325389 CGGCGGGGGGCGGCGGCCGGGGG + Intergenic
1160906007 19:1452010-1452032 TGGCAGGGGGAGGTGGCAGAGGG + Exonic
1161200090 19:3009744-3009766 AGGCAGTGGGAGGCGGGATCTGG - Intronic
1161249123 19:3270969-3270991 AGGGAGGGAGGGGCGGCCGCGGG - Intronic
1161273799 19:3404522-3404544 GGGCTGGGGGAGGCGGCCCAGGG + Intronic
1161288986 19:3482922-3482944 TGGCAGGGCGAGGAGGACGCCGG - Intergenic
1161410172 19:4112645-4112667 AGGCAGGGGCAGGCAGCGCCAGG - Intronic
1161469077 19:4447498-4447520 AGGCTGGGGGTGGGGGCAGCTGG - Intronic
1161703060 19:5805316-5805338 GGGCCGGAGGGGGCGGCCGCGGG - Intergenic
1162022564 19:7874373-7874395 AGGCGAGGGGAGGGGGCTGCGGG + Exonic
1162084357 19:8239520-8239542 AGGCCTGGGGAGGCCTCCGCAGG + Intronic
1162292713 19:9791947-9791969 AGTGAGGGGGAGGCGGGGGCGGG - Intronic
1162301519 19:9847618-9847640 AGGCAGGGAGAGGCTGACCCAGG - Intronic
1162421609 19:10568821-10568843 TGACAGGGGGAGGAGCCCGCCGG - Exonic
1162435389 19:10654828-10654850 AGCCGCGGGGAGGCGGCAGCCGG - Intronic
1162658988 19:12154977-12154999 AGGCGGAGGGAGGCGGAGGCAGG + Intronic
1162893083 19:13747995-13748017 GGCCAGGGTGAGGCGGCTGCCGG - Intronic
1162914074 19:13865180-13865202 AGGGAGGGGGCGGCGGCAGCGGG + Intronic
1162914096 19:13865276-13865298 GGGGGGGGGGAGGGGGCCGCGGG - Intronic
1162953554 19:14085827-14085849 GTGCAGGGGTAGGGGGCCGCAGG - Intronic
1162954864 19:14091995-14092017 AGGATGGGGGAGGCGGAAGCTGG + Exonic
1163029917 19:14537268-14537290 AGGGAGGGGGAGGCGGGACCAGG + Intronic
1163138765 19:15332330-15332352 GGGGAGGGGGCGGCGGCAGCGGG - Intronic
1163442458 19:17328771-17328793 AGGGCGGGGGCGGCGGCAGCGGG - Exonic
1163551171 19:17967155-17967177 GGGCCGGGGGCGGCGGCGGCAGG - Intronic
1163552565 19:17973909-17973931 TGGCAGCGTGGGGCGGCCGCTGG + Exonic
1163625698 19:18388298-18388320 ACGCAGGTGCAGGTGGCCGCCGG - Exonic
1163674934 19:18650923-18650945 CTGCAGGGAGAGGCGGCAGCTGG + Intronic
1163721457 19:18900047-18900069 AGGCAGGGTGAGGAGCCCCCTGG - Intronic
1165058731 19:33194749-33194771 GGGCAGGAGGCGGCGCCCGCGGG + Exonic
1165460120 19:35939452-35939474 AGGCAGGGGCCAGCGGCAGCAGG - Exonic
1165751732 19:38264486-38264508 AGGCAGGGCGAGCTGGGCGCAGG - Exonic
1165961688 19:39539977-39539999 AGGCCGCGGGAGGCGGGAGCCGG - Exonic
1166073056 19:40397779-40397801 AGGCAGCTGGAGGCGCCGGCGGG + Exonic
1166105731 19:40597251-40597273 CAGGAGGGGGCGGCGGCCGCTGG - Exonic
1166218481 19:41351527-41351549 AGGGAGGGGGATGAGGCCGCCGG + Intronic
1166378978 19:42344641-42344663 AGACAGGGGGTGGGGGCCGGTGG - Intronic
1166682615 19:44778122-44778144 CGGCCGGCGGAGGCGGCCCCGGG + Exonic
1166853099 19:45769628-45769650 AGGCGTGTGGAGGCGGCCGAAGG - Intergenic
1167367286 19:49061521-49061543 GGGCAGGTGGAGGGGGCTGCCGG - Exonic
1167441906 19:49513510-49513532 GGGCGGCGGGAGGCGGCCCCAGG + Intronic
1167455986 19:49596916-49596938 AGGCGGGGGCTGGGGGCCGCGGG - Exonic
1168075697 19:53980013-53980035 AGGCAGAGGGAGGGGGCGACCGG + Intronic
1168098418 19:54128417-54128439 AGGCAGAGGGCGGTGGCGGCTGG - Intronic
1168270605 19:55247688-55247710 AGGCATGGGGCGGCGGCAGGGGG + Intronic
1168379502 19:55908015-55908037 AGGCAGGGTGAGGAGGCAGACGG - Intronic
1168572922 19:57485148-57485170 AGGCAGGGAGATGAGGCCACAGG - Intergenic
925085045 2:1101214-1101236 TGGCTGGGGGAGGGGGCAGCAGG - Intronic
925134823 2:1519112-1519134 AGGCCGGGGGAGCCGCCTGCAGG + Intronic
925139675 2:1541270-1541292 AGGCAGGAGGAGGGCGCCTCAGG + Intronic
925288591 2:2731402-2731424 AGGCTGGGGAAGGAGGCAGCAGG + Intergenic
926154987 2:10448573-10448595 GGGCGGGGAGAGGCGGCCGCAGG - Intergenic
926155000 2:10448603-10448625 GGGCGGGGCGAGGCGGCCGCAGG - Intergenic
926225844 2:10966347-10966369 CTGCAGGTGGAGGCGGCAGCTGG + Intergenic
926310327 2:11670136-11670158 AGGGAGGGAGCGCCGGCCGCGGG - Exonic
927211509 2:20641808-20641830 AGGCAGCGGGAGTCAGCCGCTGG - Intronic
929532564 2:42762030-42762052 AGGCAGAGGGAGGTGGGCCCGGG - Intergenic
929562016 2:42961978-42962000 AGGGAGGGGGAGGGGGCCTGTGG + Intergenic
929592212 2:43154725-43154747 AGGCAGGGAGAGAGGGCTGCTGG + Intergenic
929647009 2:43637610-43637632 GGGCAGGGGGCGGTGGCCGGCGG + Intronic
930034931 2:47079414-47079436 AGGCAGAGGGAAGCGGGGGCGGG + Intronic
930071593 2:47370036-47370058 AGGCGGGGACAGGCGCCCGCAGG + Intronic
930104947 2:47632245-47632267 GGGAAGGAGGAGGCGGGCGCTGG + Intergenic
930575270 2:53139394-53139416 AGGCTGAGGGAGGCGGCGGATGG - Intergenic
931250720 2:60528640-60528662 TAGCAGAGGGTGGCGGCCGCAGG + Intronic
931253489 2:60552385-60552407 GGGCCGGGGGAGGAGGCGGCCGG - Intronic
933698604 2:85238291-85238313 AGGCAGCGGGAGGCGGGCTTAGG + Intronic
934179785 2:89610608-89610630 ACGCAGGGGAAGCCGGCCGGAGG + Intergenic
934290077 2:91684869-91684891 ACGCAGGGGAAGCCGGCCGGAGG + Intergenic
934678522 2:96266319-96266341 ACGCAGGGGGAGGTGGGGGCGGG - Exonic
934746172 2:96761043-96761065 CGCCAGGAGGAGGCGCCCGCGGG - Exonic
934978498 2:98822470-98822492 CGCGAGGGGCAGGCGGCCGCTGG + Exonic
935070023 2:99685940-99685962 AGGCTGTGGGAGGCGGAGGCGGG + Intronic
935275776 2:101474306-101474328 AGGCAGCGAGCGGCGGCCGTGGG + Intronic
935383589 2:102478599-102478621 AGGATGGGGGAGGGGGCAGCTGG + Intronic
935396976 2:102619567-102619589 CGGCATGGGCAGGCGGCCGGCGG + Intergenic
935463059 2:103361903-103361925 AGGCGGGAGGAGGCGGAGGCGGG - Intergenic
935463065 2:103361919-103361941 AGGCGGGAGGAGGCGGAGGCGGG - Intergenic
935592547 2:104855587-104855609 CGGCAGGGGCTGGCGGCGGCGGG + Exonic
937216945 2:120318830-120318852 AGGCAAGGTGGGGAGGCCGCAGG + Intergenic
937217703 2:120323298-120323320 AGGAGGGGGGAGGCAGCAGCAGG - Intergenic
937222676 2:120350848-120350870 AGGCAAGGGGATGAGACCGCAGG + Exonic
938876090 2:135532136-135532158 AGGCCAGGGGATGCGGCCGTGGG - Intronic
939085724 2:137716111-137716133 GAGCAGGGGGCGGCGCCCGCTGG - Intergenic
944495983 2:200307263-200307285 AGGCGAGGGACGGCGGCCGCGGG - Intronic
944743788 2:202635809-202635831 AGCAAGGGGGAGGCGGCTGCGGG + Intronic
946327551 2:218992606-218992628 GGGCAGGGGTAGGGGGCGGCAGG + Intronic
947413715 2:229871060-229871082 AGGCAAGAGGAGGCTGACGCAGG + Intronic
947602746 2:231464632-231464654 AGGCGGGCCGAGGCGGCCACGGG + Intronic
947748099 2:232519832-232519854 GGGCAGAGGCAGGCAGCCGCAGG - Intergenic
948290758 2:236822592-236822614 GGGGAGGGGGAGGCTGCAGCAGG + Intergenic
948374111 2:237509747-237509769 AGGCAGGGGGAGGCCACCTCCGG - Intronic
948461961 2:238134141-238134163 AGGCAGGGGCAGCAGGCCTCAGG + Intergenic
948816174 2:240511451-240511473 AGGCAGGAGGCAGCGGCCACAGG + Intronic
948856971 2:240734813-240734835 AGGCAGAGGGAAGCGGCCTGTGG + Intronic
948945851 2:241218392-241218414 CGCCAGGTGGAGGGGGCCGCGGG + Intronic
948991937 2:241559790-241559812 AGGCAGGGGGTGGGCGCCCCTGG - Intronic
949018107 2:241724907-241724929 AGACATGGGGAGGCGGGCCCTGG + Intronic
949057460 2:241936435-241936457 AAGCAGAGGGAAGGGGCCGCAGG + Intergenic
1168958310 20:1850025-1850047 AGGCAGGAGGCGGTGGCAGCCGG + Intergenic
1169117012 20:3072302-3072324 GGCCAGGGGGAGGCGGGCGGGGG + Intronic
1169914354 20:10672122-10672144 GGGCCGGGGGCGGCCGCCGCAGG - Intronic
1171817374 20:29800218-29800240 AGGCTGAGGGAGGTGGGCGCCGG - Intergenic
1172100906 20:32483592-32483614 AGGAAGGGGGAGGGGGCACCGGG + Intronic
1172118686 20:32585440-32585462 AGGAAGGGGGGGGCGGGCGGCGG - Intronic
1172483224 20:35284150-35284172 AGGCAGGTGGAGGACGCCGAGGG - Intronic
1172808658 20:37631761-37631783 AGGGAGGGAGAGGGGGCTGCTGG - Intergenic
1173454277 20:43190418-43190440 AAGCTGGGGCAGGCGGCTGCTGG + Intergenic
1173820021 20:46013678-46013700 GGGCAGGGGGAGCCGGCCGCAGG + Exonic
1173835075 20:46119446-46119468 AGGCAGGGGGAGGGCGGAGCTGG + Intronic
1174174687 20:48637362-48637384 AGGAAGGGGGAGGAGGTAGCGGG - Intronic
1174273187 20:49384466-49384488 ACGTAGGAGGAGGCGGCTGCTGG + Intronic
1174386541 20:50191072-50191094 AGGCAGGCGGCGGCGGCGGCAGG - Exonic
1174513766 20:51075579-51075601 AGGCAGCGGGAGAAGGCGGCTGG - Intergenic
1174615002 20:51828828-51828850 AGGCAGGGCTAGGAGGCGGCGGG + Intergenic
1175384851 20:58587617-58587639 GGGCAGGGGGAGTCGACCTCCGG - Intergenic
1175429277 20:58890990-58891012 CGGGAGGGGGAGGAGGCCTCGGG + Intronic
1175479569 20:59301595-59301617 GGGCAGGAGCAGGCGGCCGAGGG + Exonic
1175503828 20:59468349-59468371 AGGCAGGAGGAGAGGGCCCCAGG + Intergenic
1175964133 20:62652016-62652038 AGGGTGGGGGAGGCGGGGGCAGG - Intronic
1175989534 20:62780981-62781003 AGGGATGGGAAGGCGGCGGCAGG - Intergenic
1176179444 20:63742525-63742547 GGGGCGGGGCAGGCGGCCGCAGG - Exonic
1176194973 20:63832521-63832543 CGGCAGTGGGAGGCGGCTGAGGG + Intergenic
1176286034 21:5020255-5020277 AGGCAGGCCGAGGCGGCCGCGGG - Intergenic
1178263442 21:31120793-31120815 TGGGAGGAGGAGGCGGCGGCTGG - Exonic
1178626340 21:34222065-34222087 AGGAAAGGGGAGGCTGCCTCGGG + Intergenic
1178824668 21:36005037-36005059 AGGCAGGGGGAGGGGGGAGTCGG + Intergenic
1179437194 21:41369921-41369943 AGGCAGGCTGAGGGGGACGCGGG - Intronic
1179674903 21:42974738-42974760 CGGCGGCGGGCGGCGGCCGCGGG - Intronic
1179796769 21:43789542-43789564 GGCCAGGAGGAGGCGGGCGCAGG + Exonic
1179871147 21:44243220-44243242 AGGCAGGCCGAGGCGGCCGCGGG + Intergenic
1180005617 21:45019147-45019169 CGGCCGGGGGCGGCGGGCGCGGG - Intergenic
1180159531 21:45992845-45992867 AGGAAGGGGCAGGCGGAGGCTGG + Intronic
1180320706 22:11318877-11318899 AGGCTGAGGGAGGTGGGCGCGGG - Intergenic
1180766516 22:18348744-18348766 GGGCGGGAGGAGGCGTCCGCAGG + Intergenic
1180812513 22:18770955-18770977 GGGCGGGAGGAGGCGTCCGCAGG - Intergenic
1180843634 22:18970430-18970452 AGGGCGCGGGAGGCGGCGGCGGG - Intergenic
1181198670 22:21205202-21205224 GGGCGGGAGGAGGCGTCCGCAGG - Intergenic
1181311747 22:21948664-21948686 AGGGAGTGGGAGGAGGCCCCAGG - Intronic
1181527198 22:23496696-23496718 AGGCAGGGTGAGGAGGCCAGAGG + Intergenic
1182098569 22:27642174-27642196 GGGCAGGGGGAGGCCCCAGCAGG + Intergenic
1182800779 22:33030137-33030159 AGGCAGTTGGAGGCAGCAGCAGG + Intronic
1183309398 22:37101292-37101314 AGACAGGGGCAGGCGGGTGCTGG + Intronic
1183315776 22:37136172-37136194 AGGCAGGAGGGGGCGGCTGGAGG - Intronic
1183324777 22:37185255-37185277 AGGCAGGGCGTGGGGGCGGCCGG + Exonic
1183363852 22:37396951-37396973 AGGCAGAGGGAGGCTTCCGGAGG + Intronic
1183442264 22:37830020-37830042 AGGCAGGGGCAGGAGGGAGCGGG - Intergenic
1183726105 22:39590488-39590510 AGGCAGAGGGAAGCGGAGGCTGG - Intronic
1183946188 22:41327133-41327155 AGGCAGGGGCAGGAGGCCTGGGG + Intronic
1183953776 22:41367428-41367450 AGGCAGGGGCCGCCAGCCGCAGG - Intronic
1184098841 22:42330977-42330999 GGGCAGGGGGTGGCGGCCCTGGG - Intronic
1184101650 22:42344150-42344172 CGGGAGGGGGGGGCGGCCGGTGG - Intergenic
1184265301 22:43343136-43343158 AGGTGGGGGGCGGCGGGCGCGGG - Intronic
1184443617 22:44534366-44534388 AGGCAGGGTGAGGAGGCAGCTGG + Intergenic
1184453635 22:44597196-44597218 GGGCAGGGGCAGGAGGCTGCAGG + Intergenic
1184465787 22:44668481-44668503 AGGCTGTGGGCGGCGCCCGCCGG - Intergenic
1184512474 22:44941715-44941737 GGGCAGGGGGATACGGCGGCAGG + Intronic
1184519110 22:44981992-44982014 AGGCAACGGGAGGCAGCCGAGGG - Intronic
1184753016 22:46499956-46499978 AGGGTGGTGGGGGCGGCCGCTGG - Intronic
1184789261 22:46689242-46689264 AGGGAGGGGCAGGAGGCAGCAGG - Intronic
1184808495 22:46812270-46812292 AGGCAGGAGGAGGCAGCGGCAGG - Intronic
1185296855 22:50058711-50058733 CGGCGGGGTGAGGAGGCCGCGGG + Intergenic
1185338785 22:50282587-50282609 GTGCAGCGGGAGGCGGCCTCCGG - Intronic
1185386307 22:50532612-50532634 GGGAAGGGGGAGGCGGACCCAGG - Intergenic
1203228135 22_KI270731v1_random:89635-89657 GGGCGGGAGGAGGCGTCCGCAGG + Intergenic
949120065 3:374052-374074 GGGCTGGGGGAGGCGGAGGCAGG - Intronic
949614146 3:5735580-5735602 AGGCAGGGGAAGGAGGGCCCAGG + Intergenic
950099972 3:10350615-10350637 AGGCAGGGGGAGTCTGCCTGAGG - Intronic
950163153 3:10774846-10774868 AGGCAGGGGGAGGATGACCCAGG + Intergenic
950261367 3:11545104-11545126 AGCCAGGAGGCTGCGGCCGCTGG + Intronic
950811232 3:15651642-15651664 AGCCAGTGGGAGGCCGCAGCAGG - Intergenic
952287217 3:31980964-31980986 CGTCCGGGGGAGGCGGCCGCAGG - Exonic
952763308 3:36934380-36934402 AGGAAGGGGTAGGCAGCAGCTGG - Intronic
953947764 3:47163983-47164005 AGGGGAGGGGAGGAGGCCGCAGG + Intergenic
953947968 3:47164751-47164773 AGGAAGGCGGAGGAGGCTGCCGG - Intergenic
954372443 3:50175958-50175980 AGGCAGGAGGAGGTGGCAGCAGG - Intronic
954847032 3:53568480-53568502 AGGCAGGGGGATGTGGCAGTGGG - Intronic
956229606 3:66998596-66998618 AGGCAGCGGGAGGCGGCTTGAGG + Intronic
957074515 3:75591237-75591259 ATGCAGCGGGAGGCGGCTCCAGG - Intergenic
960046127 3:113200321-113200343 AGGCAGGGGCAGGCAGGGGCAGG - Intergenic
960047516 3:113212086-113212108 AGGGGGCGGGAGGCGGCCGCAGG + Intronic
960628321 3:119702966-119702988 AGGAGGAGGGAGGAGGCCGCGGG - Intergenic
960630437 3:119725302-119725324 AGGCAGGAGGATGTGGCCACTGG - Intronic
961144873 3:124585198-124585220 AGGGAGTGGGATGCGGACGCGGG + Intronic
961358130 3:126351705-126351727 AGGGAGGGGCAGGCGGGTGCAGG - Intronic
961506045 3:127371164-127371186 GAGCAGGGGGAGCCGGCTGCAGG + Intergenic
961649367 3:128409844-128409866 AGGTAGGGTGAGGAGGCCGTGGG - Intergenic
961824705 3:129592890-129592912 AGGCTGGGGGAGGGGGACACGGG + Intronic
961830161 3:129619191-129619213 GAACAGGGGCAGGCGGCCGCCGG + Intergenic
962108469 3:132417560-132417582 AGGCAGAGGGAGGAGGCGGAGGG + Exonic
962259868 3:133895536-133895558 GGGCGAGGGGAGGCGGCCGGCGG + Exonic
964003734 3:151806942-151806964 GGGCAGGGGGAGACGTCGGCAGG - Intergenic
964545635 3:157830438-157830460 AAGCAGGGGGAGAAGGCCGGGGG - Intergenic
965747037 3:171936717-171936739 AGGCAGGGGAAGGCAGCCTGGGG + Intronic
966378695 3:179322889-179322911 CGGCAGGGGGCGCGGGCCGCTGG + Intergenic
966594188 3:181711761-181711783 AGGCCGGGGGAGGAGGGGGCAGG - Intergenic
967858216 3:194134158-194134180 AGGGAGGCGGAGGAGGCGGCCGG + Intergenic
967954639 3:194868935-194868957 AGGCAGGGGGCGGCCACCGAGGG + Intergenic
968323470 3:197791597-197791619 CGGCCGGGGGAGGCGGATGCGGG + Intronic
968512969 4:1003379-1003401 GCGCAGGGTCAGGCGGCCGCCGG - Exonic
968741406 4:2333319-2333341 AGGCAAGGGGAGGCGGGGGCTGG - Intronic
969021761 4:4143796-4143818 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
969061487 4:4438756-4438778 ATGCAGGGGGAGGCTGCAGTTGG + Intronic
969185509 4:5471365-5471387 AGGCATGGGGAGAAGGCCACGGG + Intronic
969273022 4:6115830-6115852 AGGCAGGATGGGGCGGCTGCAGG + Intronic
969495333 4:7523096-7523118 AGGCAGAGGGAGGAGGCAGAGGG - Intronic
969540351 4:7784650-7784672 AGGAAGGAGGAGGCGGCCAATGG + Intronic
969714777 4:8863203-8863225 AGGCGGGTGGAGGAGGGCGCCGG + Intronic
969791702 4:9497704-9497726 GTGCGGGGCGAGGCGGCCGCGGG + Intergenic
969829493 4:9783014-9783036 ACGCAGGGGAAGCCGGCCGGAGG - Exonic
970654229 4:18213465-18213487 AAGCAGTGGGAGGCGGCTGTGGG + Intergenic
981280644 4:142954579-142954601 GAGCAGGGGGTGGCGCCCGCTGG - Intergenic
981568955 4:146131583-146131605 AGGGAGGGTGAGGCTGCCGTGGG - Intergenic
982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG + Intergenic
984805297 4:183746481-183746503 AGGCAGGGGGCCGTGCCCGCTGG + Intergenic
984952382 4:185017170-185017192 AGGAGGGGGGCGGCGGCGGCTGG - Intergenic
985441538 4:189984964-189984986 AGGCTGAGGGAGGTGGGCGCGGG - Intergenic
985484323 5:140238-140260 GAGCAGCAGGAGGCGGCCGCCGG + Exonic
985523706 5:391327-391349 GCGCAGGGCGAGGCGGGCGCAGG + Intronic
985523734 5:391425-391447 GGGCAGGGCGAGGCGGGCGCAGG + Intronic
985523749 5:391474-391496 GGGCAGGGCGAGGCGGGCGCAGG + Intronic
985523764 5:391523-391545 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523779 5:391572-391594 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523806 5:391670-391692 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523821 5:391719-391741 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523836 5:391768-391790 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523885 5:391972-391994 ACGCAGGGCGAGGAGGGCGCAGG + Intronic
985523922 5:392127-392149 ACGCAGGGCGAGGAGGGCGCAGG + Intronic
987303355 5:16616787-16616809 TTGCAGGTGGAGGAGGCCGCGGG - Exonic
988683213 5:33503206-33503228 AGGGAGGGGGAGGGGGCCCCAGG - Intergenic
990910161 5:60844274-60844296 TGGAAAGGGGAGGAGGCCGCCGG + Exonic
991419412 5:66426124-66426146 AGGAAGGGGGAAGCGGGGGCAGG + Intergenic
991493368 5:67204870-67204892 GGGCAGGAGGAGGCTGCCCCAGG + Intergenic
991720663 5:69492563-69492585 AGGGAGGGAGAGGTGGACGCGGG - Exonic
991900532 5:71455709-71455731 AGAGAGGAGGAGGCGGCGGCGGG + Exonic
992950365 5:81852004-81852026 CCGCGGCGGGAGGCGGCCGCAGG - Intergenic
997304894 5:132829988-132830010 ACCCGGGGAGAGGCGGCCGCGGG + Intronic
997530483 5:134578725-134578747 AGGCAGGCGGGTGCGGCCTCGGG - Exonic
997641102 5:135449462-135449484 AACCAGGGGGAGGCTGCCCCTGG + Exonic
997976771 5:138445629-138445651 AGGCAGGGGGTGGCGGCTCCAGG + Intronic
998119168 5:139561763-139561785 AGGCGGGTGGCGGCGGCCCCCGG - Exonic
998172995 5:139883320-139883342 AGGCAGGGGGCGGGGGGCGGGGG - Intronic
998262141 5:140639607-140639629 AGGCAGGTGTGGGCGGCCGAGGG + Exonic
998545433 5:143023584-143023606 AGGCAGGAGGAGGCAGCCACCGG + Intronic
998963126 5:147509545-147509567 GGGGCGGGGGAGGCGGGCGCGGG + Exonic
999303685 5:150506692-150506714 TGGCAGGGGGAGGGGGCAGAAGG - Intronic
1000220413 5:159209168-159209190 AGGCCGTGGGAAGCGGCCGGGGG + Intronic
1001395846 5:171419429-171419451 AGGCAGCGAGAGGCCGCGGCAGG + Intergenic
1001639133 5:173232898-173232920 GGGCAGGCGGCGGCGGCGGCGGG + Exonic
1002093490 5:176817840-176817862 AGGCCGGGGGTGGGTGCCGCGGG + Intronic
1002135043 5:177102184-177102206 AGGGAGGGGGAGGCGCACGGTGG + Intergenic
1002140406 5:177134103-177134125 GGGGAGGGGGAGGAGGCCGGCGG - Intronic
1002180612 5:177429255-177429277 AGGCATGGGGAGGGGGCCCAGGG + Intronic
1002321533 5:178378795-178378817 TGGCAGGTGGCAGCGGCCGCAGG + Intronic
1002350178 5:178577602-178577624 AGGCAGCGGGGGGCAGGCGCGGG - Intronic
1002450353 5:179315067-179315089 GGGCAGGGGGAGGAGGAGGCCGG - Intronic
1002455764 5:179344855-179344877 AGCCAGGGCGAGGCGGCGCCGGG - Intronic
1002633124 5:180594081-180594103 AGGCAGGTGCAAGGGGCCGCTGG - Intergenic
1004650194 6:17600632-17600654 AAGCGCGGGGAGGCGGCCTCCGG + Exonic
1004915908 6:20331939-20331961 AGGCTGGGGTAGGTGGCCGAGGG - Intergenic
1005040347 6:21595193-21595215 TGGCAGGCGGCGGCGGCGGCGGG + Exonic
1006185025 6:32176635-32176657 AGGCAGGTGGAGGGGGGAGCTGG - Exonic
1006333979 6:33411006-33411028 CGGCAGGAGGAGGAGGCGGCGGG - Exonic
1006433081 6:34010103-34010125 AGGCAAGGGGAGGGGGCCTGTGG - Intergenic
1006678827 6:35782571-35782593 AGGCAGGAGGGGGAGGCAGCCGG + Intronic
1006902774 6:37513694-37513716 AAGCAGGGGCTGGCTGCCGCAGG + Intergenic
1007691865 6:43707649-43707671 AGGCAGGGGCAGGAGTCAGCAGG + Intergenic
1007982296 6:46171378-46171400 AGGCAGGGGGCGGGGGGCGGGGG - Intergenic
1010245276 6:73656494-73656516 AGGCAGGTGGAGGCTGAGGCAGG - Intergenic
1011410213 6:87059702-87059724 AGTCAGGGGGAGGGGGAGGCAGG + Intergenic
1017170858 6:151452751-151452773 AGGCGAAGGGAGGCGGCCCCGGG + Intronic
1017877562 6:158536961-158536983 CGGCCGGCGGAGGCGGCCGTCGG - Intronic
1017890133 6:158631088-158631110 AGGCTGAGGGAGGCGGCCTGTGG - Intronic
1018027869 6:159819756-159819778 AGCCAGGCGGAGGGGGCAGCAGG + Intronic
1018757482 6:166862700-166862722 AGGCGGGGGGGGGGGGCGGCAGG + Intronic
1018757578 6:166863028-166863050 AGGCGGGGGGGGGCGGCCCGTGG + Intronic
1019013345 6:168860939-168860961 AGGAAGGGGGAGCCAGCAGCAGG + Intergenic
1019120785 6:169801977-169801999 AGGCAGGGGGTCGCAGCCGCAGG - Intergenic
1019157711 6:170050297-170050319 GGGCAGGGCGAGGCTGACGCGGG - Intergenic
1019198700 6:170296796-170296818 AGGCGGAGGGTGGCGGCCGCAGG - Intronic
1019342889 7:516946-516968 GGGCGGGCGGAGGCGGCCCCCGG - Intronic
1019406894 7:888700-888722 AGGCCAGGGAAGGCGGCAGCAGG - Intronic
1019473271 7:1232515-1232537 AGGGGCGGGGAGGCGGCGGCTGG + Intergenic
1019475578 7:1242623-1242645 AGGAGGCGGGAGGCGTCCGCAGG - Intergenic
1019630012 7:2043919-2043941 AGGGTGTGGGTGGCGGCCGCGGG + Intronic
1020076197 7:5260598-5260620 AGGCAGGTGGAGGAGCCGGCAGG - Intergenic
1020083643 7:5299168-5299190 AGGCAGGGGGTGGGGGAGGCAGG + Intronic
1020309179 7:6855826-6855848 GTGCGGGGCGAGGCGGCCGCGGG - Intergenic
1021101123 7:16586640-16586662 AGGCAGGCGGAGGAGGCTGCGGG + Intergenic
1021958894 7:25852913-25852935 AGGCACAGGGCGGCGGGCGCAGG - Intergenic
1022104668 7:27189335-27189357 AGGCAGCGGGAGGGCGCCGGCGG + Intergenic
1022110181 7:27225384-27225406 AGGCTTCGGGCGGCGGCCGCCGG - Intergenic
1022207612 7:28179789-28179811 GGGCCGGGGCCGGCGGCCGCGGG - Intronic
1022410378 7:30135108-30135130 CGGCGGCGGGAGGCGGGCGCGGG + Exonic
1023632807 7:42180420-42180442 AGCCAGGGGAAGGTGGCAGCTGG + Intronic
1023794511 7:43780617-43780639 AGGCAGGGGGAAGAGACCTCAGG + Intronic
1023923225 7:44645964-44645986 AGGCAGGGAGAGGCAGCTGAGGG + Intronic
1024471718 7:49773613-49773635 CGGCAGGGGGAGGCGGGAGGCGG + Intergenic
1025069762 7:55887797-55887819 AGGCGGGGGGCGGCGGGCGGCGG + Intronic
1025198618 7:56949185-56949207 AGGCTGGGGGAGCGGGGCGCGGG - Intergenic
1025202889 7:56972973-56972995 AGGCAGGTGGAGGAGCCGGCAGG + Intergenic
1025669055 7:63603953-63603975 AGGCAGGTGGAGGAGCCGGCAGG - Intergenic
1025673334 7:63627751-63627773 AGGCTGGGGGAGCGGGGCGCGGG + Intergenic
1026806153 7:73430505-73430527 AGGCAGGGGGAGGGGGAGGGGGG - Intergenic
1026822197 7:73557345-73557367 AGGCGGGAGGAGGGCGCCGCTGG - Intronic
1026846150 7:73700176-73700198 AGGCAGAGGGAGGCAGCCAGCGG - Exonic
1026899254 7:74028038-74028060 GGCCTGGGGGAGGGGGCCGCGGG - Intronic
1027185076 7:75966224-75966246 AGGCAGGGGGAGGTGAAAGCAGG - Intronic
1027774186 7:82443953-82443975 AGTCAGAGGGAGGCGGCTGGGGG + Intergenic
1029570188 7:101363590-101363612 AGGCTGGGGGTTGGGGCCGCGGG + Intronic
1029646862 7:101862418-101862440 GGGCAGGCGGAGGAGGCCACTGG - Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1029704160 7:102267060-102267082 AGGCATGGGGAGCCGGCTGGGGG + Intronic
1029704725 7:102270240-102270262 AGGCAGGGTGAGGCAGCCGGTGG + Intronic
1030215683 7:107042403-107042425 AAGCAGGGGGCGGCGGTCGTCGG + Intergenic
1030326339 7:108222669-108222691 AGGCACGTGGAGGCCTCCGCTGG - Intronic
1032074789 7:128831244-128831266 GTGCATGGGGAGGCGGCAGCTGG - Intronic
1033339230 7:140479112-140479134 GGGCGCGGGGAGGGGGCCGCGGG - Intronic
1033654136 7:143362096-143362118 AGCCAGATGGAGGCGGCGGCGGG + Intronic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034494210 7:151410269-151410291 AGGGAGGGGGAGGCGGACAAAGG + Intronic
1035110605 7:156478623-156478645 AGGCAAGGGGAGCCGGCAGCTGG - Intergenic
1035260630 7:157659368-157659390 GGGAAGGGGGGGACGGCCGCGGG + Intronic
1035317521 7:158006105-158006127 AGGCAGGAGGAAGGGGCAGCAGG - Intronic
1036241181 8:7082366-7082388 ATGCAGCGGGAGGCGGCTCCAGG + Intergenic
1036466523 8:9002906-9002928 CGGAAGTGGGAGGTGGCCGCTGG + Exonic
1036831774 8:12026177-12026199 ATGCAGCGGGAGGCGGCTCCAGG - Intergenic
1036901996 8:12676968-12676990 ATGCAGCGGGAGGCGCCTGCAGG - Intergenic
1037573371 8:20177736-20177758 AGGCAGGGGAAGGCAGCCTGTGG - Intronic
1037803640 8:22048256-22048278 AGGCAGGGGGCAGCAGCCCCTGG + Exonic
1038205312 8:25459225-25459247 AGGCGGGTGGAGGAGGCTGCCGG + Exonic
1038460168 8:27709529-27709551 AGGCAGGGGGAGGCGCTTGGGGG + Intergenic
1038883662 8:31640279-31640301 AGGAAGGCGGCGGCGGCGGCGGG + Intronic
1039953630 8:42191082-42191104 GGGCTGGGGGGGGCGGCCACTGG - Intronic
1039986580 8:42452723-42452745 GAGGAGGGGGAGGAGGCCGCAGG + Intronic
1040331998 8:46390449-46390471 GCGTAGGGGGAGGGGGCCGCAGG + Intergenic
1040507490 8:48063143-48063165 TGGCAGGGGAAGGCGGCAGGGGG - Exonic
1040546761 8:48404040-48404062 GGGCAGAGGGAGCCAGCCGCAGG - Intergenic
1041107823 8:54459023-54459045 AGGAAGGGGGAGAGGGGCGCAGG - Intronic
1041281003 8:56211337-56211359 AGGCAGGGGGAGGCAGCGGTGGG - Intergenic
1042903003 8:73746892-73746914 AGGCGGGCGGAGGCGGGCGGAGG - Exonic
1045438491 8:102187645-102187667 AGGCTGGGAGAGGCTGCCTCAGG - Intergenic
1045555048 8:103207649-103207671 TGGCAGGGGGAGGGGGCAGGTGG + Intronic
1048996293 8:139795554-139795576 AGGGAGGGGGTGGGGGCGGCGGG + Intronic
1049011355 8:139889816-139889838 AGGAAGGACGAGGGGGCCGCAGG - Intronic
1049034322 8:140062478-140062500 AGGCAGGGAGAAGCAGCAGCTGG - Intronic
1049109800 8:140635655-140635677 CGGCGGGCGGAGGCGGCGGCGGG + Intergenic
1049164362 8:141117210-141117232 GGGCAGAGGGAGGAGGCAGCAGG - Intergenic
1049290570 8:141799621-141799643 AGGCAAGGAGGGGTGGCCGCAGG - Intergenic
1049305260 8:141899489-141899511 GGGCAGGGGAAGGTGGCCGCAGG - Intergenic
1049405405 8:142449961-142449983 GGGCCGGGGGCGGCGGCGGCTGG + Exonic
1049502507 8:142974878-142974900 AGGCAGGGGGCGGGGGCCAGAGG + Intergenic
1049574691 8:143384706-143384728 AGCCAGGGGGAGGGGGGCGGAGG + Intergenic
1049582983 8:143421140-143421162 AGGGAGGGGGAAGAGCCCGCCGG - Intronic
1049583590 8:143423229-143423251 AGGGAGAGGGTGGCGGCCGAGGG - Intronic
1052022151 9:23537905-23537927 AGGGAGGGGGAGGGGGCAGAAGG + Intergenic
1053010260 9:34628900-34628922 AGGCAGGTGAGTGCGGCCGCGGG - Intergenic
1053214335 9:36258249-36258271 AGGCCGGGGGAGGCGGCCCTGGG + Intronic
1054906900 9:70420238-70420260 AGGGAGGCGGCGGGGGCCGCGGG - Intergenic
1055000826 9:71447176-71447198 GGGCAGGGTGAGGTGACCGCTGG - Intergenic
1055030357 9:71767810-71767832 AGGCAGGGGGCGGAGGGCGGAGG + Intronic
1056667623 9:88593686-88593708 GGGCAGGTGGAGGAGGCTGCAGG - Intergenic
1057128558 9:92637959-92637981 AGGTAGGCGGTGGGGGCCGCAGG - Intronic
1057221434 9:93259750-93259772 AGGCTGAGGGAGGCGGGGGCTGG + Intronic
1057226824 9:93296966-93296988 AGCCAAGGGGAGGAGGCCGAGGG - Intronic
1057303382 9:93899190-93899212 AGGCTGGGGGAGGAGGCCTTGGG + Intergenic
1057442090 9:95090421-95090443 AGACAGCCGGAGGCGGCAGCAGG - Intergenic
1059268934 9:113060589-113060611 GGGCAGGGGGAGGCGGGGTCGGG - Intergenic
1059270070 9:113066038-113066060 GGGCAGGGGGAGGCGGGGTCGGG - Intergenic
1059271204 9:113071486-113071508 GGGCAGGGGGAGGCGGGGTCGGG - Intergenic
1059272337 9:113076932-113076954 GGGCAGGGGGAGGCGGGGTCGGG - Intergenic
1059273472 9:113082374-113082396 GGGCAGGGGGAGGCGGGGTCGGG - Intergenic
1059274608 9:113087820-113087842 GGGCAGGGGGAGGCGGGGTCGGG - Intergenic
1060104975 9:120868024-120868046 AGGCAGGGGTAGGGGGCCGGGGG - Intronic
1060301339 9:122376135-122376157 TGGCTGGGGGAGGCGGGGGCTGG + Intronic
1060530088 9:124342908-124342930 AGGCAGAGGGAGCCAGCTGCTGG - Intronic
1060662250 9:125411227-125411249 AGGCAGGAGGAGGCTGCAGGTGG - Intergenic
1060756694 9:126219192-126219214 AGGCAGGGGGAGGCCAGGGCTGG - Intergenic
1060912066 9:127359098-127359120 AGGCAGTGGGGGGCGGCGGGTGG - Intronic
1061177359 9:129005807-129005829 AGGCAGGGGGAGGAGCCGGGGGG - Intronic
1061232050 9:129320802-129320824 AGGCGGGAGCAGGCAGCCGCCGG - Intergenic
1061262634 9:129488542-129488564 GGGCGTGGAGAGGCGGCCGCGGG - Intergenic
1061666415 9:132162990-132163012 GGGCTGGGGGCGGCGGCGGCCGG + Intronic
1061781769 9:133000278-133000300 TGGCGGGGGGAGGCAGGCGCCGG + Intergenic
1061828354 9:133275321-133275343 GGGGCGCGGGAGGCGGCCGCGGG + Intergenic
1061843836 9:133375893-133375915 GGGCCGGGGGAGGAGCCCGCAGG + Intronic
1061866533 9:133494281-133494303 ATGCAGGGCGAGGCTGCCCCAGG + Intergenic
1061880942 9:133568574-133568596 CGGCAGGGGGAGGGGGCAGGGGG - Intronic
1061924611 9:133799898-133799920 GGGCAGGTGCAGGCGGCCGCCGG - Intronic
1061925110 9:133802391-133802413 GGGGAGGGGGAGGCTGCCCCTGG - Intronic
1061951825 9:133940521-133940543 AGGCAGGGTGAGGGGTCAGCAGG - Intronic
1061967696 9:134025458-134025480 AGGGCGGGGCCGGCGGCCGCTGG - Intergenic
1062029734 9:134356826-134356848 AGGCAGGGTGAGGCTGGGGCAGG - Intronic
1062117414 9:134816902-134816924 AAGAAGAGAGAGGCGGCCGCAGG + Intronic
1062193685 9:135260783-135260805 AGGCAGGGGGAGGCGGGTGTGGG + Intergenic
1062206018 9:135337812-135337834 AGGCAGGGAGACGCAGCTGCAGG - Intergenic
1062247032 9:135574427-135574449 AGGAAGGGGCAGGCGGACACGGG + Intergenic
1062281626 9:135754477-135754499 AGGCAGTGGGAGGTGACTGCGGG + Intronic
1062317792 9:135977063-135977085 AGGCAGAGGGAGGCAGATGCAGG + Intergenic
1062359048 9:136178782-136178804 AGGAACGGGGAGGGGGCCCCAGG - Intergenic
1062371651 9:136242368-136242390 ACGCAGGGCGTGGCGGGCGCTGG + Intronic
1062500590 9:136850361-136850383 AGGCAGGGAGAGGAGACAGCCGG - Intronic
1062529545 9:136993885-136993907 AGGCAGGTGGAGGTGGTGGCGGG - Exonic
1062547253 9:137069384-137069406 AGGCAGGCGGGGGCTGCTGCTGG - Intronic
1062547764 9:137071274-137071296 AGGCAGGGGGACAGGGCTGCGGG - Intergenic
1062555861 9:137113176-137113198 AGGCAGTGGGAGGCGGTGGGAGG + Intronic
1062566268 9:137165319-137165341 GGGCAGGTGGAGTCGGACGCGGG - Intronic
1062613814 9:137387150-137387172 AGGCAGGGAGCGGGGGCCGAGGG - Intronic
1062740885 9:138174927-138174949 AGGCTGAGGGAGGTGGGCGCGGG + Intergenic
1203772757 EBV:57932-57954 GGACAGAGGGAGGCGGCGGCCGG + Intergenic
1203368926 Un_KI270442v1:284651-284673 AGGCTGAGGGAGGTGGGCGCGGG - Intergenic
1185778993 X:2829392-2829414 AGGCTTGGGGAGGGGGGCGCGGG + Intronic
1186199042 X:7137811-7137833 AGGCAGGAAGAGGAGGCTGCCGG - Intronic
1186205616 X:7197022-7197044 AGCCAGGGGGAGGCAGATGCAGG - Intergenic
1189107973 X:38256398-38256420 AAGCCGGGGGAGGGGGGCGCTGG - Intronic
1190113235 X:47608723-47608745 AGCCTGGGGGAGGAGGCCACCGG - Intronic
1190118904 X:47644655-47644677 AGCCAGGTGGAAGCGGCAGCCGG + Intronic
1191054963 X:56232242-56232264 AGGCTGAGGGAGGCGGCCGCCGG + Intergenic
1192180346 X:68912217-68912239 GTGCAGGGGGCGGCTGCCGCCGG + Intergenic
1192183216 X:68929320-68929342 AGGTAGAGGGAGGCGGCGGGAGG + Intergenic
1192847868 X:74924807-74924829 TGGCTCGGGGTGGCGGCCGCAGG - Intronic
1196297446 X:114015183-114015205 GGACAGGGGGAGGCGGCGGAGGG + Intergenic
1196746276 X:119073754-119073776 AGGCTGGGCGTGGGGGCCGCGGG + Intergenic
1196893504 X:120311456-120311478 AGGGAGGGGGAGGCGGCACTTGG - Intronic
1198245465 X:134827205-134827227 CGGGAGGGGGAGGCGGAGGCGGG - Intronic
1198275428 X:135094521-135094543 AGGCAGTGGGAGGTGACCTCAGG + Intergenic
1198311086 X:135426176-135426198 AGGCAGTGGGAGGTGGCCTCAGG - Intergenic
1198942191 X:141968185-141968207 ACGCAGGGGGAGGCTGAGGCAGG - Intergenic
1199511899 X:148631684-148631706 AGGCAGGGGGAGGAGGGCATGGG + Intronic
1199772411 X:150983496-150983518 AGGCAGGGGGAGGCGGCGGCAGG - Intronic
1200047302 X:153409762-153409784 GGGCAGGGGAAGGGGGCCCCTGG - Intergenic
1200100900 X:153688702-153688724 CGGCACGGCCAGGCGGCCGCCGG - Exonic