ID: 1136220391

View in Genome Browser
Species Human (GRCh38)
Location 16:28824055-28824077
Sequence CAGTAGGAGGGGAGCGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 0, 3: 63, 4: 414}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136220380_1136220391 -7 Left 1136220380 16:28824039-28824061 CCCTTCCCGGTCTGGCCAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 203
Right 1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG 0: 1
1: 0
2: 0
3: 63
4: 414
1136220378_1136220391 -5 Left 1136220378 16:28824037-28824059 CCCCCTTCCCGGTCTGGCCAGTA 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG 0: 1
1: 0
2: 0
3: 63
4: 414
1136220379_1136220391 -6 Left 1136220379 16:28824038-28824060 CCCCTTCCCGGTCTGGCCAGTAG 0: 1
1: 0
2: 0
3: 10
4: 246
Right 1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG 0: 1
1: 0
2: 0
3: 63
4: 414
1136220382_1136220391 -8 Left 1136220382 16:28824040-28824062 CCTTCCCGGTCTGGCCAGTAGGA 0: 1
1: 0
2: 1
3: 14
4: 79
Right 1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG 0: 1
1: 0
2: 0
3: 63
4: 414
1136220377_1136220391 -2 Left 1136220377 16:28824034-28824056 CCTCCCCCTTCCCGGTCTGGCCA 0: 1
1: 0
2: 2
3: 39
4: 396
Right 1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG 0: 1
1: 0
2: 0
3: 63
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136220391 Original CRISPR CAGTAGGAGGGGAGCGAGGT GGG Intronic
900105529 1:979334-979356 CAGAGGGAGGGGGGCGAGGCAGG + Exonic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900761939 1:4478577-4478599 CAGTTGGAGGGGAACGTGGGAGG - Intergenic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
901018359 1:6244077-6244099 GAGGAGGAGGGGACCGAGGGAGG - Intergenic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
903341032 1:22654368-22654390 CAGTTGGTGGGGAGAGAGGGTGG - Intronic
903872552 1:26447010-26447032 CAGTAGAAGGGGAGAGGGTTAGG + Intronic
904538391 1:31216246-31216268 GAGCAGGAGTGGAGCGAGGAGGG + Intronic
904877546 1:33668096-33668118 GAGCAGGAGGGGTGAGAGGTGGG + Intronic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
905363973 1:37438767-37438789 GAGAAGGAGGGAAGCAAGGTGGG + Intergenic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
906191969 1:43904746-43904768 CAGGAGGAGGGGAGAGTGGTGGG - Intronic
906214680 1:44031725-44031747 CAGCTGGAGGGCAGCGAGGCAGG - Intergenic
906792866 1:48674065-48674087 CAGTAAGAGGCGAGCGTGGGAGG - Intronic
907193201 1:52665702-52665724 AAGAAGGATGGGAGGGAGGTGGG - Intronic
907976002 1:59432050-59432072 CACCAGGAGGGGAGAGAGGCTGG + Intronic
911559460 1:99386076-99386098 CAGTAGGAGATAAGAGAGGTTGG + Intergenic
911760993 1:101616541-101616563 CAGTAGGTGCGGGGTGAGGTTGG + Intergenic
912509857 1:110181852-110181874 GAATAGGAGGGGAAGGAGGTAGG + Intronic
912679897 1:111722344-111722366 CAGGAGGAAGGGAGCGATGTGGG + Exonic
915316734 1:155033036-155033058 CAGGATGAGGGGGGCGAGGGGGG + Intronic
915557779 1:156669890-156669912 CAGGAGGAGGGGAGGGAGCCAGG - Exonic
917036063 1:170748174-170748196 GAGTAGGAGGGAAGGGAGGGAGG - Intergenic
920008429 1:202850446-202850468 CAGAAGGAAGGGAAAGAGGTTGG - Intergenic
920342637 1:205284982-205285004 AAGCAGGGGGGGAGCCAGGTTGG - Intergenic
920560913 1:206937755-206937777 CAGGATGAGGGGTGCAAGGTAGG + Intronic
920849268 1:209617709-209617731 CAGAAGGAGGGGTGAGAGGTGGG - Intronic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922789853 1:228305615-228305637 CAGTGGGAGGGAAACAAGGTGGG - Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923534432 1:234838180-234838202 GAGGAGGAGGGGGGCGGGGTAGG + Intergenic
924033467 1:239910738-239910760 GAGAGGGAGGGGAGGGAGGTGGG + Exonic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063216074 10:3926796-3926818 CAATGGGAGGGGGGCGAGTTTGG - Intergenic
1064002621 10:11676108-11676130 CAGGAGGAAGAGAGCGAGGCAGG - Intergenic
1064229537 10:13517861-13517883 CAGTAGCAGGGGAGCGGGGCTGG - Intronic
1064817959 10:19288422-19288444 CAGGAGGCTGGGAGGGAGGTGGG - Intronic
1065176923 10:23086540-23086562 CAGAAGGAAGAGAGAGAGGTGGG + Intergenic
1065759088 10:28965013-28965035 CAAGAGGAGGGGAGAGAGGAGGG - Intergenic
1065765635 10:29026941-29026963 AAGAAGGAAGGGAGGGAGGTAGG + Intergenic
1067283949 10:44894187-44894209 CAGAAGGAGGGGAGTCAGGAGGG + Intergenic
1067719909 10:48720295-48720317 CAGGAGGAGGGAAGAGGGGTCGG + Intronic
1068050892 10:51947598-51947620 CAGCAGGAGGGGAGCCAAGATGG - Intronic
1069617726 10:69816833-69816855 CAGTAGGGGAAGAGCCAGGTAGG + Intronic
1070001150 10:72378427-72378449 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
1070394896 10:76003382-76003404 CAGAAGGAAGGGAGAGAGGATGG - Intronic
1071471224 10:85985383-85985405 CAGTTGGGGGAGACCGAGGTGGG - Intronic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1071863462 10:89700244-89700266 CAGTTAGTGGGGAGTGAGGTCGG + Intergenic
1072746383 10:97941923-97941945 CAGAAGGAGGCCAGTGAGGTAGG - Intronic
1073255619 10:102149154-102149176 TAGTAGGAGGAGAGTGAGGCAGG - Intronic
1074399135 10:113127290-113127312 GGGGAGGAGGGGAGCGAGGAGGG - Intronic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075704843 10:124494518-124494540 GAGAAGGAGGGCATCGAGGTGGG - Intronic
1075753227 10:124791310-124791332 GAGTAGGAGGGGAGGGATGTGGG - Intronic
1076193784 10:128500632-128500654 CAGCGGGAGGGGAGCGAGGCAGG - Intergenic
1076668249 10:132104926-132104948 CAGCAGGAGAAGAGCAAGGTGGG + Exonic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1077981358 11:7303810-7303832 CAGTAGGAGGGCAGCAGGGAAGG - Intronic
1078333995 11:10450112-10450134 CAGGAAGAGGTGAGCGAGGGAGG + Intronic
1079169702 11:18081140-18081162 CAGGAGGAGGGGAGGGAGAGAGG - Intronic
1079967308 11:26994722-26994744 CAGGGGGAGGGGAGCCAGGTTGG + Exonic
1080061619 11:27962377-27962399 AGGAAGGAGGGGAGCCAGGTGGG - Intergenic
1080258312 11:30318363-30318385 CAGTAGGAGCTGGGCCAGGTTGG - Intergenic
1080846403 11:36030830-36030852 CAGTAGGAGAGGAGAGAGCCAGG + Intronic
1081023696 11:37981860-37981882 CAGCAGGAGGTGAGCGTGGGTGG + Intergenic
1081659604 11:44879950-44879972 CAGTTGGAGGAGAGAGAGCTGGG - Intronic
1081709660 11:45208733-45208755 CAGTAGGAGGAGGGTGTGGTGGG + Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082849849 11:57754834-57754856 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083595252 11:63915886-63915908 CCGGGGGAGGGGAGCGGGGTTGG + Intronic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1084393225 11:68892060-68892082 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393236 11:68892097-68892119 GTGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393247 11:68892137-68892159 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393258 11:68892177-68892199 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393269 11:68892216-68892238 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393281 11:68892256-68892278 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393293 11:68892296-68892318 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393305 11:68892336-68892358 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393317 11:68892376-68892398 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393329 11:68892416-68892438 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393341 11:68892456-68892478 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393353 11:68892496-68892518 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393365 11:68892536-68892558 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393377 11:68892576-68892598 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393389 11:68892616-68892638 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393399 11:68892656-68892678 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393408 11:68892696-68892718 GAGGAGAAGGGGAGCGAGGCTGG + Intronic
1084534283 11:69747535-69747557 CATCACGAGGGGAGCGAGGTGGG - Intergenic
1085445385 11:76597703-76597725 CAGTGGCAGGGGAGCGGGGACGG + Intergenic
1085817237 11:79752216-79752238 CAGTAGGAGAGGGGTGGGGTTGG - Intergenic
1087779918 11:102291018-102291040 CAATAGGAGGGGAGGGAGCTGGG - Intergenic
1088653037 11:111975144-111975166 TAGTAGGAGGGTAGGAAGGTAGG + Exonic
1089160663 11:116434506-116434528 CAGTGGGAGGGGAGCATTGTTGG + Intergenic
1090203351 11:124871121-124871143 CAGAAGGAGGGGAGTCAGGTGGG + Exonic
1090357069 11:126147232-126147254 CAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1091641563 12:2241065-2241087 CAGTACGAGGTGAGGGGGGTGGG + Intronic
1091652837 12:2322646-2322668 CAGAAGGAAGGGAGAGAGGGAGG - Intronic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1091978203 12:4843735-4843757 CAGAAGCAAGAGAGCGAGGTGGG + Intronic
1092049768 12:5459957-5459979 CAGTGGGAGGGTGGTGAGGTGGG - Intronic
1092462524 12:8698478-8698500 GAGTCGGTGGGGAGCGAGGCGGG + Intronic
1092688804 12:11084003-11084025 AAGAAGGAGGGGTGTGAGGTAGG - Intronic
1092712343 12:11352533-11352555 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092716079 12:11392253-11392275 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1093934639 12:24987817-24987839 CAGTTATAGGGGAGGGAGGTGGG - Intergenic
1093989371 12:25572807-25572829 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1094194157 12:27728702-27728724 CAGGAAGAAGGGAGGGAGGTGGG - Intronic
1094493441 12:30975500-30975522 CAGGAGGAGGGGAGAGAGCTTGG - Intronic
1094495057 12:30984055-30984077 CCGAAGGAGGGGAGCCAGGAAGG + Intronic
1095939065 12:47713942-47713964 GAGCAGGAGGGGAGAGTGGTAGG + Intronic
1096160377 12:49371735-49371757 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1096674881 12:53221086-53221108 CAGGAGGAGGTGAGCGCGCTCGG - Intronic
1097269579 12:57765814-57765836 AGGTAGGCGGGGAGTGAGGTTGG + Intronic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1098587247 12:72168676-72168698 CAGTTGGAGGGAAGAGATGTTGG - Intronic
1099169716 12:79349108-79349130 CAGGAGGAAGGGAGGAAGGTAGG + Intronic
1099663099 12:85591686-85591708 CAGTAGGCGGGGACCATGGTAGG - Intergenic
1101254442 12:102963804-102963826 AAGTAGGAGGGGATATAGGTTGG + Intergenic
1102029665 12:109732670-109732692 CAGAAGGAGGGGAGGTGGGTGGG + Intronic
1102251278 12:111389263-111389285 TACTAGGAGGGGACCGAGGAAGG + Intergenic
1102653802 12:114463045-114463067 CAGTGTGAGGGAAGCAAGGTGGG + Intergenic
1102933816 12:116881102-116881124 CAGTAGGTGGGGAGCGCGCCGGG + Exonic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103681918 12:122700924-122700946 CACTTTGAGGGGACCGAGGTGGG - Intergenic
1104170823 12:126278592-126278614 CAGCAGGAGGGGAGAGAGAGAGG - Intergenic
1104734968 12:131131076-131131098 CAGTAGGAGGCTGGCGAGGCAGG - Intronic
1107826456 13:44332820-44332842 GAGTAGGTGGGGAGTGAGATGGG - Intergenic
1107972150 13:45654036-45654058 CAGGAGCAAGCGAGCGAGGTTGG + Intergenic
1108260011 13:48646774-48646796 CAGCAGGAGAGGAGATAGGTTGG - Intergenic
1110290879 13:73805603-73805625 CAGAAGGAAGGGAGGGAGGGAGG + Intronic
1112027153 13:95421583-95421605 CAGTAGGAGGTGAGCTAGGAAGG + Intergenic
1112108998 13:96273964-96273986 GAGGAGGAGGGGAGGGAGGGAGG - Intronic
1114487605 14:23072218-23072240 CAGTAGAAGGGGGGCAGGGTTGG + Intronic
1114773562 14:25455969-25455991 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1115006882 14:28496612-28496634 CAGGAGGAAGGGAGAGAGGAAGG - Intergenic
1116737125 14:48706055-48706077 CAGTAGAAGGGCAGCAAGTTTGG + Intergenic
1116739498 14:48736144-48736166 CAGGAGAAGGAGAGCAAGGTGGG + Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1118722048 14:68601292-68601314 CAGAAGGAGGACAGCCAGGTAGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119102809 14:71895913-71895935 GAGTAGGAGGAGAGTGAGGTTGG - Intergenic
1120257591 14:82140188-82140210 CAGTAGGCGGGGTGCGTGGTGGG - Intergenic
1120336779 14:83167612-83167634 CAGTGGGAGTGGAGTAAGGTGGG - Intergenic
1120725684 14:87937493-87937515 CAGGAGTAGGGGAGTGAGGTGGG + Intronic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1122040401 14:98983779-98983801 CAATAGGAAGGGAGGGAGGAAGG + Intergenic
1124420511 15:29517076-29517098 CAGGAGGAGGAGAGGCAGGTTGG + Intronic
1125881759 15:43201645-43201667 CAGGAGGATGGGAGTGAGGCAGG - Intronic
1125896797 15:43309245-43309267 CAGTATGAGTGGAATGAGGTTGG + Intergenic
1126490776 15:49233244-49233266 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1127427103 15:58867408-58867430 CAGTAAGAGGGGAGAGTGTTTGG - Intronic
1127589222 15:60406829-60406851 AAGTAGGAGGGAAGCAAGGAGGG + Intergenic
1128225308 15:65997306-65997328 CAGTAGGAGGTCAGCTTGGTGGG + Intronic
1128704575 15:69829215-69829237 GAGGAGGAGGGGAAGGAGGTGGG - Intergenic
1129168477 15:73793280-73793302 CAACAGGAGGGGAGTCAGGTTGG - Intergenic
1129246403 15:74281647-74281669 CAGGAGGGTGGGAGGGAGGTGGG - Intronic
1129521508 15:76189343-76189365 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1131149877 15:90040699-90040721 CTGGAGTTGGGGAGCGAGGTGGG - Intronic
1131241412 15:90747010-90747032 AAGCTGGAAGGGAGCGAGGTGGG - Intronic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131665215 15:94564266-94564288 CAGGAGGAAGGGAGAGAGGGGGG + Intergenic
1131842304 15:96450406-96450428 CAGTAGGATGGGGGCGGGGGTGG - Intergenic
1132102542 15:99034804-99034826 GAGTAGGAGAAGAGAGAGGTGGG + Intergenic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1133639280 16:7701290-7701312 CAGCAGGTGGTGAGCGGGGTGGG + Intronic
1133978510 16:10617246-10617268 AAGTAGGAGGAGTGGGAGGTAGG - Intergenic
1134756385 16:16671136-16671158 CAATAGGAGGCGAGCCAGATTGG + Intergenic
1134989684 16:18688027-18688049 CAATAGGAGGCGAGCCAGATTGG - Intergenic
1135686423 16:24501624-24501646 TAGGAGGAGGAGAGAGAGGTGGG - Intergenic
1135976775 16:27113634-27113656 GAGCAGGAGGAGAGAGAGGTGGG + Intergenic
1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG + Intronic
1136867668 16:33769906-33769928 CAGGAGGAGGGGAGTGTGGCAGG + Intergenic
1138610488 16:58119791-58119813 CAGTAGATGGCGAGTGAGGTGGG - Intronic
1138610502 16:58119867-58119889 CAGTAGATGGCGAGTGAGGTGGG - Intronic
1138610516 16:58119943-58119965 CAGTAGATGGCGAGTGAGGTGGG - Intronic
1140482186 16:75267629-75267651 CAGGAGCAAGGGAGGGAGGTGGG - Intronic
1141524796 16:84604307-84604329 CCGTGGGAGGGGAGCGTGGGTGG - Intronic
1203104494 16_KI270728v1_random:1346297-1346319 CAGGAGGAGGGGAGTGTGGCAGG - Intergenic
1203129020 16_KI270728v1_random:1616071-1616093 CAGGAGGAGGGGAGTGTGGCAGG + Intergenic
1142548188 17:720417-720439 CAGTAGGATGTGAGGGAGTTGGG + Intronic
1142548211 17:720511-720533 CAGTAGGCTGTGAGGGAGGTGGG + Intronic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1144959815 17:19038756-19038778 CAGCAGGAGGGGAGCGTAGGGGG + Intronic
1144975345 17:19135768-19135790 CAGCAGGAGGGGAGCGTAGGGGG - Intronic
1145083525 17:19915981-19916003 CAGTAGAAGGTGAGTGAGTTGGG - Intronic
1145831740 17:27921722-27921744 CAGTAGGAGGTCAGAGAGATAGG - Intergenic
1146002593 17:29140211-29140233 AAGTAGGTGGGGAGAGGGGTGGG - Intronic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1148450893 17:47777303-47777325 TAGTGGGATGGGAGTGAGGTGGG + Intergenic
1148785798 17:50145680-50145702 GAGGAGGAGGGGAGAGAGGATGG + Intronic
1149671587 17:58417655-58417677 CAGGAGGAGGGGGGCAGGGTGGG - Intergenic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151454081 17:74215638-74215660 GAGTAGGAGATGAGCGTGGTGGG + Intronic
1151534243 17:74729736-74729758 GAGCAGGAGGAGAGCAAGGTGGG - Intronic
1151896353 17:76983290-76983312 AAGTGGGAGGGGAGCGGGGTGGG - Intergenic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152184260 17:78844281-78844303 CAGTACCAGGGGAGCGATGCAGG - Intergenic
1152342257 17:79731626-79731648 CAGGAGGAGGGGAGTGTGGCGGG + Intronic
1152558983 17:81068481-81068503 CTGTAGGAGGGCAGCGATGCAGG + Intronic
1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG + Intronic
1153634882 18:7104931-7104953 CTGTAGCAGGGAAGCCAGGTAGG + Intronic
1153825174 18:8868285-8868307 CAGTAGGAAAGGTGCTAGGTTGG + Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157514767 18:48303043-48303065 CAGTAATAGGGAAGCGAGGGAGG - Intronic
1157761184 18:50266664-50266686 CTGGAGGAAGGGAGCAAGGTCGG - Intergenic
1158413966 18:57232962-57232984 CAGTAGGAGAGCAGCCTGGTTGG - Intergenic
1158448500 18:57542251-57542273 CTGCAGGAAGGGAGCAAGGTGGG + Intergenic
1159418804 18:68188101-68188123 CAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1160066433 18:75578885-75578907 CTGTAGAAGGGGAGGGAGTTAGG - Intergenic
1160497302 18:79383095-79383117 CAGTAAGAGGAGAGCAGGGTGGG + Intergenic
1160535744 18:79590387-79590409 CACAAGGAGGCGAGAGAGGTGGG - Intergenic
1160565520 18:79784557-79784579 CAGTGGGAGGGAAGAGGGGTTGG - Intergenic
1160806237 19:993409-993431 CGGGAGGAAGGGAGCCAGGTGGG - Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1162378348 19:10317827-10317849 CAGTGGCAGGGGGGCGGGGTGGG - Intronic
1163475602 19:17524226-17524248 CAGCAGGAGGGGATAGAGGATGG - Intronic
1163760229 19:19132539-19132561 TATTAGGAGGGGAGCGAGCTGGG - Intronic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1164424036 19:28124363-28124385 CAGCAGGAGGGCAGCCAGGCTGG + Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1165428165 19:35756848-35756870 TAGTAGGGGGCGAGCGTGGTGGG + Exonic
1165648886 19:37468872-37468894 AATTGGGAGGGGAGCGGGGTGGG - Intronic
1165778975 19:38421100-38421122 CAGCAGGCGGGCAGCCAGGTCGG + Exonic
1166329599 19:42070262-42070284 CAGGAGGAAGGGAGGGAGGCAGG + Intronic
1166641579 19:44498887-44498909 CAGTAGGAGGGAGTCTAGGTGGG - Intronic
1168302025 19:55410567-55410589 CATTAGGAGGCCAGCGAGGCTGG + Intergenic
925068654 2:950191-950213 AAGGAGGAGGGGAGCGGGGTTGG + Intergenic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
925587336 2:5476500-5476522 CAGTTGGAAGGGTGTGAGGTGGG - Intergenic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
929236340 2:39609120-39609142 GGGTAGGAGGGGAGTTAGGTGGG + Intergenic
930120385 2:47756001-47756023 CAGCAGGAGGGGAGCCAGCCGGG - Intronic
932460183 2:71876954-71876976 AAGTTGGAGGGGAGGGAGGGAGG + Intergenic
932743803 2:74314405-74314427 CTCTAGGTGGGCAGCGAGGTTGG + Intronic
935178586 2:100670726-100670748 CAGGAGGAGGGTGGAGAGGTGGG - Intergenic
935262249 2:101365362-101365384 CAGCAGGAGGTGAGCAAGGTTGG + Intronic
935301532 2:101697643-101697665 GCGGAGGCGGGGAGCGAGGTGGG - Intronic
936531641 2:113280100-113280122 CAGTGGGAGGGGGGCAAGGAAGG + Intergenic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
936980196 2:118256705-118256727 CAGTGGGAGGTGAGCAAGGCTGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937363469 2:121244669-121244691 CAGTAGGAGAGAATTGAGGTAGG - Intronic
939476511 2:142694357-142694379 CACTAGGACAGGAGCGAGGCTGG + Intergenic
939952063 2:148487340-148487362 AAGAAGGAGGGGAGCAAGGAAGG + Intronic
942731744 2:179067594-179067616 CAGGAGGAGGAGAGCAAGGGAGG - Intergenic
944080442 2:195781948-195781970 CAGAATGAGGGGTGAGAGGTGGG + Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946801655 2:223423741-223423763 CAGTAGCAAGAGAGCAAGGTGGG - Intergenic
946911458 2:224465372-224465394 CAGAAGGAAGGGAGCAAGGAAGG - Intergenic
947655231 2:231821093-231821115 CAGTAGGAGGGGAATGAGCTGGG - Intergenic
947736057 2:232456167-232456189 CAGCAGGAGGGAGGCGAAGTGGG - Exonic
947794714 2:232887006-232887028 CAGGAGGAGTGGCCCGAGGTGGG + Intronic
948230026 2:236342672-236342694 CAGCAGGAGAGGAGCGGGGGAGG - Intronic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948766898 2:240227041-240227063 CAGTTGGAAAGGAGTGAGGTAGG + Intergenic
948807927 2:240460923-240460945 CGGTAGGAGGGGAGCCTGGCTGG + Intronic
948971769 2:241433918-241433940 CAGTAGGAGGGGAGCGGCTGAGG + Intronic
1169345200 20:4823492-4823514 AAGGAGGAGGGGAGCGAGGAGGG - Intronic
1169526845 20:6437676-6437698 AAGTGGATGGGGAGCGAGGTTGG + Intergenic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1171405237 20:24908336-24908358 CTGTTGGAGGGGTGGGAGGTGGG + Intergenic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1171862402 20:30412933-30412955 AAGTAGGGAGGGAGGGAGGTAGG + Intergenic
1172223671 20:33290268-33290290 GAGTAGGACGGGAGCCAGGGAGG + Intronic
1172613409 20:36267689-36267711 CTGTGGGAGGGGAGCTGGGTGGG - Intronic
1172777111 20:37414274-37414296 GGGTAGTAGGGGAGGGAGGTAGG - Intergenic
1173921709 20:46751052-46751074 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
1173943493 20:46932123-46932145 TATTAGGCGGGGGGCGAGGTAGG - Intronic
1174117593 20:48237925-48237947 CTGCAGCAGGGGAGTGAGGTGGG - Intergenic
1174163919 20:48571222-48571244 CTGCAGCAGGGGAGTGAGGTGGG + Intergenic
1174358572 20:50014341-50014363 CAGAAGGAGGGGAGTCAGATGGG + Intergenic
1174951367 20:55044819-55044841 CAGGAGCAAGAGAGCGAGGTGGG - Intergenic
1174960522 20:55151769-55151791 GAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1175329712 20:58155195-58155217 CAGCAGGAGGGGATGGAGATGGG + Intronic
1175442974 20:59003777-59003799 CAGGAGCAGGGGAGCAAGGGCGG + Intronic
1175612880 20:60366112-60366134 CCGGAGGAGGGGAGAGACGTTGG - Intergenic
1175851897 20:62098108-62098130 AAGCAGGAGAGGAGCCAGGTAGG + Intergenic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1175958029 20:62621337-62621359 TAGTAGGAGGGCATCGGGGTGGG - Intergenic
1176184595 20:63771381-63771403 CAGAAGGAGGGGAGGGAGAGAGG + Intronic
1177169725 21:17641662-17641684 CAGAAGGAGGCTAGAGAGGTGGG + Intergenic
1178297891 21:31426168-31426190 CAGGAGGAAGGGTGGGAGGTGGG - Intronic
1178626825 21:34225316-34225338 CAGCAGGAGGAGGGAGAGGTGGG + Intergenic
1179629053 21:42665579-42665601 CTGTAGGAGCAGAGCAAGGTCGG - Intronic
1180024811 21:45154965-45154987 CAGTGGGAGGGGAGAGAGATGGG + Intronic
1181885306 22:26017367-26017389 AAGGAGGAGGGGAGGGAGGAAGG - Intronic
1182103282 22:27672053-27672075 CAGGAGGAAGGGAGAGAGGAAGG + Intergenic
1183046206 22:35222484-35222506 CAGTAGGAGGAGAGCAATGGGGG - Intergenic
1183059328 22:35326638-35326660 CACTAGGAGGAGAGAGAGGGTGG + Intronic
1183279031 22:36922429-36922451 CAGGAGGAGGGAAGCGGGGGAGG - Intronic
1183318618 22:37150187-37150209 ATGTAGGAGGGGAGAGAGGGAGG - Intronic
1183650725 22:39152084-39152106 CAATAAAAGGGGAGCGAGGTGGG + Intronic
1183661422 22:39223841-39223863 CAGTAGGTGGGAAGGGAGGTGGG + Exonic
1183736822 22:39649015-39649037 CAGCAGGTGGGGAGCGGGGAAGG - Intronic
1184748400 22:46469977-46469999 GAGGAGGAGGGGAGGGAGGGAGG + Intronic
1185019907 22:48367955-48367977 CAGCTGTAGGGGAGCCAGGTGGG + Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
951543559 3:23805826-23805848 CAGGGGGAGGGGAGCGCGGGTGG + Intergenic
953472292 3:43177586-43177608 GAGTGGAAAGGGAGCGAGGTGGG + Intergenic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
954717759 3:52534742-52534764 CTGTCGGAGGGGAGCCAGCTGGG + Intronic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
956659684 3:71584563-71584585 CAGTTGAAGGAGAGCGGGGTGGG + Intergenic
956697004 3:71926934-71926956 AATTAGGAGGAGAGCAAGGTTGG - Intergenic
960223787 3:115147082-115147104 GGGAAGGAGGGGAGCGGGGTGGG - Intronic
960332593 3:116380514-116380536 CAGTGGCAGGGGAGTGGGGTAGG - Intronic
965630896 3:170731437-170731459 CAGTAGGAGGGGAGCAGAGAGGG + Intronic
967950866 3:194839406-194839428 CAGGAGGAAGGGAGCGAGGCGGG + Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
967976180 3:195035859-195035881 CAATCGGGGGGGAGCGTGGTGGG + Intergenic
968628528 4:1638574-1638596 GGGTAGGAGGTGAGAGAGGTGGG + Intronic
968817697 4:2830222-2830244 GAGTGCCAGGGGAGCGAGGTGGG - Intronic
969348212 4:6582219-6582241 CAGTGGGAAGGGAGTGGGGTTGG - Intronic
969512858 4:7629562-7629584 CAGCGGGTGGGGAGCGAGGGGGG - Intronic
970488198 4:16545217-16545239 CAGAAGGAAGGGAGGGAGGGGGG - Intronic
971327914 4:25658923-25658945 GAGCAGGAGGGGAGGGTGGTGGG - Intronic
971357941 4:25911974-25911996 CAGAAGGAGGGCTGAGAGGTGGG - Intronic
972072935 4:35044736-35044758 CAGGAGGTGGTGAGGGAGGTTGG + Intergenic
973093765 4:46171501-46171523 CAGTTGGTGGGGAGGGAGGGAGG - Intergenic
973854439 4:54996718-54996740 GAGTAGGAGGGAAGAGAGATAGG + Intergenic
974430278 4:61788276-61788298 AGGTAGGAGGGGATTGAGGTGGG - Intronic
974839871 4:67287250-67287272 CAGTAGGAGAGGGGAGAGGTGGG + Intergenic
975302714 4:72809611-72809633 TATCAGGAGGGGAGTGAGGTGGG + Intergenic
975541936 4:75522571-75522593 TAGTAGGATGGGGGGGAGGTGGG - Intronic
975811611 4:78175746-78175768 CAGTAGGAAGGGAGGCAGGAAGG + Intronic
976142154 4:82003599-82003621 CAGGAGGAAGAGAGCGAAGTGGG - Intronic
979768164 4:124488479-124488501 CGGAAGGAGGGGAGGGAGGGAGG + Intergenic
980289300 4:130824971-130824993 CAGGAGGAGGAGAGCCAGGTGGG - Intergenic
981409911 4:144417700-144417722 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
982197427 4:152930454-152930476 CAGTAGGAGGCCAGCAAGTTAGG + Intergenic
984189012 4:176582392-176582414 CAGGAGGAAGAGAGAGAGGTGGG - Intergenic
984814669 4:183825336-183825358 CAGTAGGTTGGGAGGAAGGTGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985767581 5:1787922-1787944 GAGCAGGAGGGGAGGGAGGAGGG - Intergenic
985805418 5:2039376-2039398 CAGCAGGAGGGGCCCGAGCTGGG + Intergenic
986547482 5:8914345-8914367 CAGTAGGAAGAGAGCAAAGTGGG + Intergenic
988539245 5:32094521-32094543 CAGGAGGCGAGGAGAGAGGTTGG + Intronic
988779018 5:34502480-34502502 GAGAAGGAGGGGAGTGAGGATGG - Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
990782959 5:59386684-59386706 CAGGAGGAAGGGAGGGAGGGAGG + Intronic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
994077321 5:95667927-95667949 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
996479084 5:123952964-123952986 AAGGAGGAGGGAAGCCAGGTGGG + Intergenic
997335854 5:133108738-133108760 CAGTAGGGTGGGAGCTGGGTGGG + Intergenic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
998533398 5:142906494-142906516 CAGTAGGAAGGGAGAGAGGGAGG - Intronic
999178365 5:149648382-149648404 CAGGAGGAGGAGAGCAAGGAGGG - Intergenic
999269790 5:150290070-150290092 CAGTTGGAGGTGGGGGAGGTGGG - Intronic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1001587129 5:172840562-172840584 GAGCAGCAGGGGAGCCAGGTCGG + Intronic
1002189691 5:177472247-177472269 CACTGGGAGGGCAGCCAGGTGGG - Exonic
1005631058 6:27708423-27708445 AAGTAGGGAGGGAGGGAGGTAGG - Intergenic
1006333927 6:33410879-33410901 CTGTTGGAGGTGAGGGAGGTGGG + Intronic
1006425490 6:33960463-33960485 CAGTCTGAGGGAAGAGAGGTTGG - Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006731339 6:36238593-36238615 CAGGAGGAAGGGAGCAAAGTGGG + Intergenic
1007112713 6:39322308-39322330 CAGGTGAAGGGGAGCGATGTGGG - Exonic
1007406413 6:41638428-41638450 GAGTAGGGGAGGAGCGAGGGGGG + Exonic
1011543740 6:88462471-88462493 TACTAGGAGGGGAGGGAGGGAGG + Intergenic
1011708056 6:90023393-90023415 CAGGAGGAGGGAAGAGAGGAGGG - Intronic
1011742611 6:90377637-90377659 GAGGAGGAGGGGAGGGAGGGAGG - Intergenic
1011743641 6:90387985-90388007 AAGGAGGAGGGGAGAGAGGGAGG - Intergenic
1012121782 6:95377842-95377864 CAGCAGGAAGGGAGACAGGTTGG + Intergenic
1012335686 6:98053616-98053638 CAGTAGGAGTGGAGAGAGAGTGG + Intergenic
1013522046 6:110942448-110942470 CAGCACTATGGGAGCGAGGTAGG - Intergenic
1013612143 6:111805624-111805646 CAGGAAGAAGGGAGCCAGGTGGG - Intronic
1016722862 6:147323052-147323074 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1016739607 6:147513384-147513406 GGGTGGGAGGGGAGAGAGGTTGG + Intronic
1017769832 6:157636496-157636518 CAGCAGGAGGGAAGTGAGGATGG - Intronic
1017871888 6:158493736-158493758 CAGGAGGAGGGGAGCAAGGCAGG - Intronic
1018405106 6:163472395-163472417 CAGAAGGAGGTGATGGAGGTGGG + Intronic
1018410295 6:163538496-163538518 CAGTAGGAGGTGAGGTCGGTGGG + Intronic
1020164342 7:5796414-5796436 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1022289069 7:28983936-28983958 CAGGAGGAGGAGAGAGAGGGAGG + Intergenic
1023350234 7:39313195-39313217 CAGGAGGAGGGAAGTGAGGCTGG - Intronic
1023820232 7:43976803-43976825 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1023864839 7:44233727-44233749 CAGTTGGAGCGGAGCATGGTGGG + Intronic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1024213714 7:47228765-47228787 CAGGAGGAGGGAGGCGAGGCTGG - Intergenic
1024581097 7:50801850-50801872 CAGTAGGAGGGCAAGGAGGGTGG - Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025724380 7:64043928-64043950 TAGGAGGAGGGGAGAGAGTTGGG - Intronic
1026444874 7:70475397-70475419 CAGTATGAGGGGGGAAAGGTGGG - Intronic
1026562956 7:71465600-71465622 CAGTAGGAGGAGATCGGGCTGGG - Intronic
1027182382 7:75949968-75949990 CAGGAGGAGGGAGGTGAGGTGGG - Intronic
1027889398 7:83951195-83951217 CAGTAGGAGGTGAGTGATGGAGG - Intergenic
1028270942 7:88788299-88788321 AAGCAAGAGGGGAGTGAGGTTGG - Intronic
1029748520 7:102530324-102530346 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1029766467 7:102629408-102629430 CAGGAGAAGGGGTGGGAGGTGGG + Intronic
1030379977 7:108800765-108800787 CAGGAGGAGGGGAGAGGGGAAGG - Intergenic
1030438063 7:109551448-109551470 GAGTATGGGGGGAGGGAGGTGGG + Intergenic
1030925008 7:115441018-115441040 AAGGAGGAAGGGAGGGAGGTAGG + Intergenic
1031796848 7:126185934-126185956 AAGTAGCAGGGGAGTGAAGTGGG + Intergenic
1033213753 7:139479642-139479664 CAGGGGGAGGGTAGCGTGGTAGG + Exonic
1033807674 7:144973199-144973221 AAGTGGGAGAGGGGCGAGGTGGG + Intergenic
1034162044 7:149001159-149001181 CAGGAGCAAGGGAGCGAGGGTGG - Intergenic
1034895696 7:154875151-154875173 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035026836 7:155831726-155831748 CAGTGGGAGGAGCGCGGGGTCGG + Intergenic
1035579207 8:729374-729396 CAGGAGGAGGGGATGGAGCTTGG - Intronic
1036024666 8:4892057-4892079 CAGTAGAAGGTGCGGGAGGTAGG + Intronic
1036646156 8:10612383-10612405 CAGCAGGAGGCCAGCGAGGGAGG - Exonic
1037049024 8:14345806-14345828 CAGTAGGAAGGGATGGAGTTTGG - Intronic
1037356606 8:18026685-18026707 GAGGAGGAGGAGAGAGAGGTAGG - Intronic
1037806430 8:22060150-22060172 CAGGAAGAGGGGAGGGAGGGAGG - Intronic
1037887832 8:22604460-22604482 CAGAGGGAGGCGAGCGTGGTAGG + Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038339530 8:26673896-26673918 GAGGAGGAGGGGAGGGAGGAAGG - Intergenic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1039309337 8:36298563-36298585 CAGGAGCAGGAGAGCAAGGTGGG + Intergenic
1040777013 8:51057507-51057529 CACTAGGAAGGAAGGGAGGTTGG + Intergenic
1041330525 8:56719328-56719350 AAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1043375686 8:79646963-79646985 GAGTTGGAGAGTAGCGAGGTGGG + Intronic
1043417266 8:80063969-80063991 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1047081417 8:121465535-121465557 GAGAAGGAAGGGAGGGAGGTGGG + Intergenic
1047218728 8:122901272-122901294 CAGAAGCAGGGGAGGTAGGTTGG - Intronic
1048244165 8:132775507-132775529 GAGCAGGAGCGGAGCGAGCTGGG - Exonic
1048842973 8:138581285-138581307 CAGCAGGGGTGGAGTGAGGTGGG - Intergenic
1049291715 8:141806839-141806861 CAGGAGCAGGGAAACGAGGTGGG + Intergenic
1049361201 8:142213213-142213235 GAGTCGGAGGGGAGAGAGGGAGG - Intronic
1049618587 8:143587782-143587804 CAGTGGGAGTGGCACGAGGTGGG - Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1051476817 9:17517526-17517548 CCTTAGGAGGGGAGAGAGATTGG + Intergenic
1051658770 9:19407614-19407636 CAGGAGGAAGGGATAGAGGTTGG + Intergenic
1052094598 9:24369243-24369265 CAGTTGGTGGGGGGCTAGGTGGG + Intergenic
1052293135 9:26866965-26866987 CAGTAGGAGGTGAGCGGTGGTGG + Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1056089430 9:83190025-83190047 CAGGGGGAGGGAAGCGAAGTGGG - Intergenic
1056924846 9:90825696-90825718 ATGTAGGAAGGGAGCAAGGTGGG + Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1058504384 9:105653653-105653675 TGGTAGGAGGGGAGTGGGGTAGG - Intergenic
1058646390 9:107135132-107135154 CACTAGATGGGGAGGGAGGTAGG - Intergenic
1059439986 9:114301411-114301433 CAGAAGCAGGGGAGAGAGTTAGG - Intronic
1059780696 9:117523238-117523260 CAGTAGGTTGGGAGCGGGGCTGG + Intergenic
1059929456 9:119246708-119246730 CAGTATGAGAGAAGGGAGGTGGG - Intronic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060729859 9:126030503-126030525 CAGCAGGAAGGGAGAGAGGGTGG - Intergenic
1060884522 9:127141031-127141053 GAGTAGGAGAGGACCCAGGTGGG + Intronic
1060943632 9:127557467-127557489 CAGGAAGAGGGGAGGGAGGGCGG + Intronic
1062530453 9:136997261-136997283 CAGTGGGAGGGATGGGAGGTGGG - Intergenic
1062729809 9:138102631-138102653 CAGCAGGAGGGGAGCGGGGAGGG - Intronic
1185999226 X:4989366-4989388 CAGAAGGAGGGAGGGGAGGTAGG - Intergenic
1186876133 X:13820038-13820060 CAGTAGGTTGGGAACCAGGTAGG + Intronic
1188005901 X:25015655-25015677 CAGTAGGAGGAGAGCAAAGTTGG + Exonic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1189960358 X:46318637-46318659 AAGGAGGAAGGGAGCGAGGGAGG + Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1195065785 X:101236984-101237006 CATTTGGAGGGCAGCGGGGTAGG + Intronic
1195597664 X:106711165-106711187 GAGTAGGTGGGGAGAGAGGCTGG - Intronic
1195908054 X:109864849-109864871 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1196059811 X:111395844-111395866 CACTAGGAGAAGAGAGAGGTTGG + Intronic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1198114906 X:133535603-133535625 CAGAAGGAAGGCAGGGAGGTGGG + Intergenic
1198187408 X:134266951-134266973 CAGGAGAAGGGGAGAGAAGTGGG + Intergenic
1199271450 X:145888130-145888152 CAGTAGCAGGGGAGGGTGTTGGG - Intergenic