ID: 1136222192

View in Genome Browser
Species Human (GRCh38)
Location 16:28835851-28835873
Sequence GCCATAGTGCTCCCTAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136222188_1136222192 -8 Left 1136222188 16:28835836-28835858 CCTGGTGCCACCCTTGCCATAGT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1136222185_1136222192 5 Left 1136222185 16:28835823-28835845 CCATTGCCAAGTCCCTGGTGCCA 0: 1
1: 1
2: 2
3: 28
4: 237
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1136222187_1136222192 -7 Left 1136222187 16:28835835-28835857 CCCTGGTGCCACCCTTGCCATAG 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1136222181_1136222192 19 Left 1136222181 16:28835809-28835831 CCATGGGGACCATCCCATTGCCA 0: 1
1: 0
2: 2
3: 14
4: 133
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1136222184_1136222192 6 Left 1136222184 16:28835822-28835844 CCCATTGCCAAGTCCCTGGTGCC 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1136222180_1136222192 26 Left 1136222180 16:28835802-28835824 CCGTCTGCCATGGGGACCATCCC 0: 1
1: 0
2: 2
3: 22
4: 203
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1136222186_1136222192 -1 Left 1136222186 16:28835829-28835851 CCAAGTCCCTGGTGCCACCCTTG 0: 1
1: 0
2: 2
3: 25
4: 243
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1136222182_1136222192 10 Left 1136222182 16:28835818-28835840 CCATCCCATTGCCAAGTCCCTGG 0: 1
1: 0
2: 5
3: 25
4: 317
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1136222179_1136222192 27 Left 1136222179 16:28835801-28835823 CCCGTCTGCCATGGGGACCATCC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1136222192 16:28835851-28835873 GCCATAGTGCTCCCTAACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136222192 Original CRISPR GCCATAGTGCTCCCTAACTC TGG Intronic