ID: 1136226786

View in Genome Browser
Species Human (GRCh38)
Location 16:28865225-28865247
Sequence AGTCTGGGGCCAGAGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136226786_1136226793 -2 Left 1136226786 16:28865225-28865247 CCTGCGGCCTCTGGCCCCAGACT 0: 1
1: 0
2: 2
3: 30
4: 297
Right 1136226793 16:28865246-28865268 CTGAAGGGATACCAAAGAAGTGG 0: 1
1: 0
2: 1
3: 12
4: 214
1136226786_1136226794 -1 Left 1136226786 16:28865225-28865247 CCTGCGGCCTCTGGCCCCAGACT 0: 1
1: 0
2: 2
3: 30
4: 297
Right 1136226794 16:28865247-28865269 TGAAGGGATACCAAAGAAGTGGG 0: 1
1: 0
2: 1
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136226786 Original CRISPR AGTCTGGGGCCAGAGGCCGC AGG (reversed) Intronic
900108556 1:996426-996448 CGTCTGGGGCCACAGGATGCAGG + Intergenic
900108605 1:996558-996580 CGTCTGGGGCCACAGGATGCAGG + Intergenic
900108655 1:996690-996712 CGTCTGGGGCCACAGGATGCAGG + Intergenic
900108704 1:996821-996843 CGTCTGGGGCCACAGGATGCAGG + Intergenic
901662369 1:10806572-10806594 TGGCTGGGGCCAGAGGACCCAGG - Intergenic
901739936 1:11335204-11335226 TGTCCGGGGCCAGAGGACTCAGG - Intergenic
903069223 1:20718266-20718288 AGACTGGGGCCCGGGGCCCCAGG + Intergenic
903224735 1:21888086-21888108 AGACTGGAGTCAGAGGCGGCAGG + Intronic
903280885 1:22249213-22249235 AGGCTGGGGCCAGGGGCAGCTGG + Intergenic
903938280 1:26911607-26911629 AGTCTTGGCCCAGAGGCTGTGGG + Exonic
904283987 1:29442398-29442420 AGTCTGGCTCCAGAGCCTGCGGG + Intergenic
904410848 1:30323970-30323992 TGTCTGGGCTCAGAGGCAGCTGG + Intergenic
904474538 1:30756587-30756609 AGTCTGCATCCAGAGGCCGTGGG + Intronic
905318829 1:37101312-37101334 ACTCTGGGGCCAGAGGCTGCAGG - Intergenic
905738057 1:40344444-40344466 AGACTGGGACCAGAGGGCCCGGG - Intergenic
905749438 1:40449874-40449896 AGTCTGGGGCCCAAGAACGCAGG + Intergenic
906180582 1:43815042-43815064 AGCCTGAGGACAGAGGCCCCAGG - Intronic
908824180 1:68117491-68117513 TGTCTGGGGCCAGAAGCTGATGG - Intronic
909321059 1:74286341-74286363 AGCCTGAGGCCTGAGGCCACAGG - Intronic
911233057 1:95380751-95380773 AGTCTGTGGCCAAAGGCCCAAGG + Intergenic
911978514 1:104534717-104534739 AGTCTGTGGCCAAAGGCCAGGGG - Intergenic
912277321 1:108273117-108273139 TGGCTGGGTCCAGAGGCTGCGGG - Intergenic
912290907 1:108421239-108421261 TGGCTGGGTCCAGAGGCTGCGGG + Intronic
915079938 1:153345221-153345243 AGTCTGCAGCCAGAGACTGCGGG - Exonic
915098789 1:153483938-153483960 AGGCAGGGGCCAGATGCCCCGGG - Intergenic
915142813 1:153777575-153777597 AGGCTGGGGACAGGGGCCGGGGG + Intronic
916052992 1:161049105-161049127 AGTCTGGAGGGAGAGGCAGCAGG - Exonic
916578665 1:166088904-166088926 AGTCAGAGGCCAGAGGATGCAGG - Intronic
917349161 1:174058762-174058784 AGTCTGAGGCCAAAGGCCTCAGG - Intergenic
919803871 1:201369372-201369394 GGTCTGGGGACAGAGTCCTCTGG - Intronic
921024032 1:211260465-211260487 AGTCCAGGGTCCGAGGCCGCGGG + Intronic
921757236 1:218872890-218872912 AGGCTGGGGCCAGAGTGTGCAGG + Intergenic
922359733 1:224810489-224810511 GGCCTGGGGCCTGAGGCTGCTGG - Intergenic
924567414 1:245210254-245210276 AGGCTGAGGCCAGAGGCTGCGGG - Intronic
924845930 1:247770993-247771015 ACTCTGGGGCCAGAAGCCCTGGG - Intergenic
1063462265 10:6222207-6222229 AGTCTGAGGCCAGAGGACAGTGG - Intronic
1063804545 10:9623428-9623450 AGTCTGTGGCCAAAGGCCTGAGG + Intergenic
1064458249 10:15508544-15508566 AGTGTGGGGTGAGAGGCCACTGG + Intergenic
1064679980 10:17801099-17801121 AGTCTGTGGCCAAAGGCCCGAGG + Intergenic
1065173755 10:23057125-23057147 AGTCTGTGGCCAAAGGCCCGAGG + Intergenic
1065655912 10:27949728-27949750 ACTCTGGCTGCAGAGGCCGCTGG + Intronic
1066165809 10:32787804-32787826 AGGCTGGCCCCAGAGGCCCCAGG + Intronic
1067473785 10:46553525-46553547 CCTCAGGGGCCAGAGGCTGCTGG - Intronic
1067803361 10:49375890-49375912 TGGCTGGTGCCAGAGGCAGCAGG - Intronic
1070764595 10:79049042-79049064 AGTCTCGGCCCAGAGGCTGAAGG - Intergenic
1072113354 10:92345018-92345040 AGCCTGGTCCCAGAGGCAGCTGG + Intronic
1073131228 10:101190342-101190364 AGCCTGAGGCCAGAGGCATCCGG + Intergenic
1073484384 10:103807418-103807440 GGCCTGGGGCCAGGGGCAGCTGG - Intronic
1073509202 10:104032792-104032814 AGTCTGGGGACTGAGGGCACAGG + Intronic
1074034074 10:109720228-109720250 AGTCTGTGGCCAAAGGCCCGAGG - Intergenic
1074114724 10:110447215-110447237 AGTCTGTTGCCAGAGGAAGCCGG + Intergenic
1074687043 10:115971084-115971106 AGTGTGGAGCCAGAGGGAGCAGG + Intergenic
1075440260 10:122474520-122474542 AGTCCGTGGCCAGAGGCTGGAGG + Intronic
1076410287 10:130244442-130244464 AGAAAAGGGCCAGAGGCCGCAGG - Intergenic
1076479108 10:130772713-130772735 AGCCTGGGGCAAGAGGGCGAAGG - Intergenic
1077024903 11:434793-434815 AGTCTGGGGCCAGAACCTTCCGG + Intronic
1077094603 11:793965-793987 GGGCTGGGGCCAGAGGTCACAGG + Intronic
1077249297 11:1553988-1554010 AGGGTGGGGGCAGAGGCTGCTGG - Intergenic
1077295923 11:1826310-1826332 AGTGTGGGGCCAGCAGCCGTGGG + Intergenic
1077816509 11:5691005-5691027 AGTCCGAGGAGAGAGGCCGCAGG + Intronic
1083719619 11:64597942-64597964 AGGGTGCGGCCAGAGGGCGCTGG + Intronic
1083766041 11:64842134-64842156 AGTCTGGGGCCAGGGGTCCAGGG - Intronic
1084109247 11:67002848-67002870 AGTCTGGGTCCTCAGGCCTCAGG + Intergenic
1084307982 11:68299091-68299113 AGTCTGGGACCAGGGGCAGCTGG - Intergenic
1085293678 11:75418182-75418204 AATCTGGGGCCAGGGGCAGCAGG - Intronic
1086028736 11:82327075-82327097 AGTCTGGAGCCTGGGGCCTCTGG - Intergenic
1086420204 11:86631051-86631073 GGTCTGGGGCCTGAGGCCCTGGG + Intronic
1089281854 11:117380332-117380354 AGTCAGGAGCCAGAGGCTGAAGG - Intronic
1089498594 11:118920006-118920028 GCTCTGGGACCAGAGGCCACTGG + Intronic
1090250919 11:125251078-125251100 ACTCGGGGGCTACAGGCCGCTGG - Intronic
1090271637 11:125389993-125390015 GCTCTGGGCCCAGAGGCCTCAGG + Intronic
1091300062 11:134502026-134502048 AGGGTGGGGCCAGAGGCAGGAGG + Intergenic
1091915844 12:4271459-4271481 AGGCAAGGGACAGAGGCCGCCGG - Intergenic
1092319148 12:7453034-7453056 AGTCTGGAGCCTGAGGCCATTGG - Intronic
1092384704 12:8027092-8027114 AGGTTGGCGCCAGAGGCAGCAGG - Intergenic
1092987295 12:13857995-13858017 AGTCTAGAGACAGAGGCTGCTGG - Intronic
1094723179 12:33085911-33085933 AGCCTGGGAGCAGAGGCAGCAGG + Intergenic
1094794169 12:33951085-33951107 AGCCTGGGGTCAGAGGAGGCGGG + Intergenic
1094819193 12:34211499-34211521 AGTCTCGGCGCAGAGGCTGCCGG + Intergenic
1095692034 12:45100673-45100695 AGTTTGGGGCCAGAGTGCGAAGG - Intergenic
1095970611 12:47899663-47899685 AGCCTGGAGACAGAGGTCGCAGG - Intronic
1096101650 12:48973578-48973600 ACTCTGGGACAAGAGGCCACAGG + Intergenic
1096182459 12:49558188-49558210 AGGCTGGGGGCAGAGGCCTGAGG + Exonic
1096496365 12:52041626-52041648 AGCCTGGGGGCCGAGGCCCCAGG - Intronic
1097970724 12:65630184-65630206 AGCGTGGGGCCAGATGCTGCGGG + Intergenic
1098245644 12:68514349-68514371 GGTCGGGGGCCAGGGGCCGGGGG + Intergenic
1102677190 12:114666956-114666978 ATTCTGGGGCCAGGAGCTGCAGG - Intergenic
1103252083 12:119508671-119508693 AGGCAGGGGCCAGAGCACGCAGG + Intronic
1106226338 13:27789829-27789851 AGGCGGCGGGCAGAGGCCGCGGG + Intergenic
1107013344 13:35689520-35689542 AATCTGTGGCCAAAGGCCCCAGG - Intergenic
1108287969 13:48927482-48927504 AGTCTGTGGCCAAAGGCCTGAGG - Intergenic
1110765518 13:79276541-79276563 AGTCTTGGGCCAGAGTCCCAGGG - Intergenic
1115131024 14:30051949-30051971 AGTCTGTGGCCAAAGGCCCAAGG - Intronic
1119265171 14:73260045-73260067 AGTCTGGGCCCAGAAGCACCTGG - Intronic
1121489887 14:94350195-94350217 AGTCTGTGGCCAGGAGCCCCTGG + Intergenic
1121633668 14:95439489-95439511 AGTGTGGAGCCAGGGGCCGTGGG - Intronic
1122414090 14:101540577-101540599 AGTGTGGGAGCAGAGGCTGCCGG + Intergenic
1122809161 14:104279432-104279454 AGGCTGGGGCCAGATGCCTCGGG + Intergenic
1122885832 14:104709893-104709915 AGTGTGGGGCTGGAGGCCTCTGG + Intronic
1123000448 14:105291190-105291212 AGAGCAGGGCCAGAGGCCGCAGG + Intronic
1123128867 14:105969611-105969633 ATTCTGGGACCAGAGACCTCAGG + Intergenic
1123500448 15:20877306-20877328 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1123557693 15:21450999-21451021 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1123578429 15:21695363-21695385 AGTGTGGGCCCAGAGGCCACAGG - Intergenic
1123593920 15:21888280-21888302 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1123615054 15:22137845-22137867 AGTGTGGGCCCAGAGGCCACAGG - Intergenic
1125413601 15:39429982-39430004 TGTCTGGGGCCAGGAGCCCCAGG + Intergenic
1125523274 15:40359693-40359715 AGAGAGGGGCCAGAGGCCCCAGG - Intronic
1125652734 15:41330892-41330914 ATTCTGGGGCCAGAGGCAGAAGG - Intronic
1125744284 15:41988189-41988211 AGTGTGGGGCCTGGGGCTGCAGG - Intronic
1125749871 15:42020893-42020915 TGGCTGGGGCCAGAGGCTGAGGG - Intronic
1126709793 15:51443338-51443360 AGCCTGGAGCCTGAGGCTGCTGG + Intergenic
1127263472 15:57343197-57343219 AGTCTGAGATCAGGGGCCGCCGG - Intergenic
1129111183 15:73338196-73338218 TGGCTGGGGCCACAGGCCACCGG + Intronic
1129221599 15:74134638-74134660 GGTCAGGGGCCTGAGGCCGCAGG - Exonic
1129689918 15:77707363-77707385 GGTCTGTGGCCACAGGCCTCAGG - Intronic
1129922174 15:79328806-79328828 AGCCTGGGGGCAGAGGCCCCTGG + Intronic
1130304036 15:82700818-82700840 AGTCTGGGGCAGGGGGCTGCAGG - Intronic
1202966045 15_KI270727v1_random:178171-178193 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1202987299 15_KI270727v1_random:429608-429630 AGTGTGGGCCCAGAGGCCACAGG - Intergenic
1132721727 16:1319876-1319898 AGTCTGGGAACACAGGCCCCAGG - Intronic
1132902609 16:2266418-2266440 AGTCTGGAGCCAGAGGGCCTGGG + Intronic
1133175546 16:4011357-4011379 ATTCTGGGGCCACGGGCAGCAGG + Intronic
1133246692 16:4453788-4453810 AGTTTGGGGCCACAGGTCCCCGG - Intronic
1136075966 16:27817359-27817381 AGTCTGGGGCCAGAGAGAGAGGG - Intronic
1136226786 16:28865225-28865247 AGTCTGGGGCCAGAGGCCGCAGG - Intronic
1136458803 16:30397516-30397538 AGCCTCGGGACAGAGGCCCCCGG + Exonic
1141573419 16:84948487-84948509 ACTCTGCGGCCTGAGGCTGCGGG + Intergenic
1142134436 16:88445095-88445117 AGCTGGGGGCCAGAGGCCTCAGG + Intergenic
1142962153 17:3557726-3557748 TGTCTGGGGCCCAAGGCCCCCGG + Exonic
1143166706 17:4900528-4900550 AGTTAGGGGCCAGAGGCGGCGGG + Exonic
1143591428 17:7887734-7887756 AGGCGGGGGCCGGAGGGCGCAGG - Intronic
1143639885 17:8189856-8189878 TGTCTGGGGCCGGGAGCCGCAGG - Exonic
1145026398 17:19471006-19471028 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145112376 17:20175021-20175043 AGGGTGGGGTCAGAGGCCCCTGG + Intronic
1145276909 17:21437016-21437038 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145314741 17:21722909-21722931 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145713183 17:26994846-26994868 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1146017638 17:29246804-29246826 GGCCAGAGGCCAGAGGCCGCAGG + Intergenic
1146559708 17:33857533-33857555 AGTCTAGGCTCAGAGGCCTCTGG + Intronic
1146938163 17:36825574-36825596 AGGCCGGGGCAGGAGGCCGCTGG - Intergenic
1147377659 17:40032538-40032560 AGGCTGGGCCCAGTGCCCGCAGG + Intronic
1147879780 17:43646164-43646186 GGCCTGGAGCCAGAGGCCGCCGG - Intronic
1148201531 17:45753079-45753101 AGTCTGGGGCCAGAGAGGGCAGG - Intergenic
1148441360 17:47713286-47713308 AGTGTGGGGACACAGGGCGCAGG + Intergenic
1148444237 17:47727864-47727886 AGTCTGGGCCCAGAGGGGGAGGG + Intergenic
1148832141 17:50440610-50440632 AGTCGGGGGCTAGAGGTCACTGG - Intronic
1149896109 17:60429645-60429667 AGGCTGGGGGCAGAGGCTCCCGG - Intronic
1151901433 17:77018228-77018250 AGTCTGGGGCCATTTGCAGCTGG + Intergenic
1152174908 17:78781558-78781580 AGTCTGGGCCCGGTAGCCGCCGG - Intronic
1152426921 17:80223057-80223079 AGACTGGGGTCTGAGGCCACAGG - Intronic
1152563198 17:81088915-81088937 AGGCTGGAGCCAGAGGCCTGAGG + Intronic
1152632062 17:81414788-81414810 AGGCTGGGGGCGGAGGCGGCAGG + Intronic
1152728857 17:81960347-81960369 CGGCTGGGCCCAGAGGCCGAGGG + Intronic
1153960542 18:10136314-10136336 AGTCTGGGGCCAGAGAACCTAGG + Intergenic
1154162599 18:11991164-11991186 AGGCAGGGGCCACAGGCCACGGG + Intronic
1157872266 18:51241428-51241450 AGCCTGGGGCCAGATGCTGGAGG + Intergenic
1159836430 18:73342420-73342442 ACTCTGGCTCCAGAGGCTGCTGG + Intergenic
1162898131 19:13777716-13777738 AGGCTGGGACCAGAGGCTGTGGG + Intronic
1163123425 19:15231750-15231772 CGTCTGGGGCCAGGGGCCTGAGG - Intronic
1163816023 19:19465061-19465083 TGTTGGGGGCCAGAGGCAGCAGG - Intronic
1164564422 19:29315730-29315752 AGTGTGGGGCCTGAGGCCACTGG - Intergenic
1164855494 19:31517638-31517660 GGGCTGTGGCCAGAGGCCGCGGG + Intergenic
1165073811 19:33269872-33269894 AGCCTGGGGCTAGGGGCAGCTGG - Intergenic
1165364978 19:35359778-35359800 GCTCTGGGGCCAGTGGCAGCAGG + Exonic
1165366797 19:35372247-35372269 GCTCTGGGGCCAGTGGCAGCAGG + Exonic
1165460120 19:35939452-35939474 AGGCAGGGGCCAGCGGCAGCAGG - Exonic
1166690211 19:44817940-44817962 AACCTGGGGCCAGAGGTGGCAGG + Intronic
1167044725 19:47042883-47042905 AGCCCGGGGCCAGAGCCCACAGG + Exonic
1167385047 19:49158052-49158074 AGTCTGGAGCGGGAGGGCGCTGG + Intronic
1168009380 19:53518303-53518325 AGCCTGTGGCCAGAGGCCACAGG - Intergenic
1168252669 19:55149322-55149344 AGTGTGGAGCCAGGGGCAGCAGG - Exonic
925009275 2:469688-469710 AATCTGGGGCCAGAGTCCACTGG + Intergenic
925135102 2:1521502-1521524 AGTCTGGGGAAAGAGGGCCCTGG - Intronic
927635592 2:24813779-24813801 GCTCTGAGGCCAGAGGCTGCAGG + Intronic
928099102 2:28424617-28424639 AGTCTGGAGCCAGAGGTTGGGGG + Intergenic
929333951 2:40717279-40717301 AGTCTGTGGCCAAAGGCCCGAGG - Intergenic
929772224 2:44902086-44902108 ACTCTGGCACCAGAGGCTGCTGG + Intergenic
929969932 2:46565245-46565267 AGTATGGGGCCAGGGTCCCCAGG + Intronic
931217450 2:60259973-60259995 GGTTTTGGGCCAGAGGCTGCTGG - Intergenic
934117702 2:88812220-88812242 AGTCAGGGGCCACAGGCATCAGG - Intergenic
935147896 2:100408740-100408762 AGACTGTGGCCAGAGGATGCAGG + Intronic
937775105 2:125767037-125767059 ACTGTGGGGCCAGAGGGCACAGG + Intergenic
938087934 2:128413618-128413640 AGTCTGGAGTCAGAAGCTGCAGG - Intergenic
938162338 2:128997223-128997245 TGTCTGGGGACAGAGCCCTCAGG + Intergenic
940981351 2:160007337-160007359 GGTCTGGGGGCAGAGGCTGGGGG - Intronic
942171900 2:173297653-173297675 AGTAGGGGGCCGGAGGCCCCGGG + Intergenic
946868992 2:224069098-224069120 AGTCTGGAGCCAGGGGCCCAGGG + Intergenic
947076902 2:226354798-226354820 ACTCTGGGGCCAGATCCCCCAGG - Intergenic
947198985 2:227598112-227598134 AGTAAGGGTCCAGAGGCCCCAGG - Intergenic
947613087 2:231536000-231536022 AGCCTGGGGCCAGTGTCCACGGG - Intergenic
947665131 2:231900665-231900687 TGCCTGGTGCCAGAGGCCGCAGG + Intergenic
948486918 2:238287397-238287419 AGCCTGGGACCAGAAGCCCCAGG + Intronic
948764477 2:240212438-240212460 ACACTGGGGCCTGAGGCTGCTGG - Intergenic
949060436 2:241953556-241953578 AATCTGTGGCCAGAGGCTGTGGG + Intergenic
1170562205 20:17568168-17568190 AGGCTGAGGCCAGAGGCAGACGG + Intronic
1171120791 20:22567794-22567816 AGTCTCTGCCCAGAGGCCGGCGG + Intergenic
1172112082 20:32552924-32552946 AATCTGGGGGCGGAGGCTGCAGG + Intronic
1174420354 20:50395457-50395479 AGTCTCTGGCCAGAGCCTGCGGG + Intergenic
1174569740 20:51492955-51492977 AGCTTGGGGCCAGAGGCTCCAGG + Intronic
1175199846 20:57269255-57269277 AGGCTGGGGGCAGGGGCAGCAGG + Intergenic
1175998521 20:62821848-62821870 AGTCTGGGGGTGGAGGCCACAGG - Intronic
1176014517 20:62923108-62923130 AGGCTGAGGCCAGAGGCCAGAGG - Intronic
1176037365 20:63046242-63046264 AGTCTGGGGACAGCGGCTCCTGG - Intergenic
1176167719 20:63682730-63682752 AGAGTGGGGCCAGTGGCCCCAGG + Intronic
1176243422 20:64085300-64085322 TGGCTGGGGCCAGAGCCCCCTGG - Intronic
1177894344 21:26843238-26843260 GGAGTGGGGCCAGAGGCTGCTGG - Intronic
1179285000 21:39969702-39969724 ATCCTGGGGGCAGAGGCCCCTGG + Intergenic
1180338735 22:11600953-11600975 GGTCTGGGGCCAGGGTCCCCAGG - Intergenic
1180830955 22:18905923-18905945 GGTCTCGGGCCAGAGCCCACAGG - Intergenic
1181068889 22:20320411-20320433 GGTCTCGGGCCAGAGCCCACAGG + Intergenic
1181108535 22:20588447-20588469 AGGCTGTGGCCAGGGGCAGCAGG + Intergenic
1181135022 22:20759153-20759175 AGTCTGGGGGCTGAGGCAGGGGG - Intronic
1182761787 22:32728371-32728393 GGGCTGGGCCCAGAGGCAGCTGG - Intronic
1183311052 22:37109649-37109671 AGCCTGAGGCCACAGGCCACAGG - Intergenic
1184131537 22:42519579-42519601 AGCCTGGGGCCACGGGCCACCGG + Intronic
1184141759 22:42581795-42581817 AGCCTGGGGCCACGGGCCACCGG + Intergenic
1184512558 22:44942086-44942108 AGTCTGGGGCCAGAAGAGCCTGG + Intronic
1184731063 22:46371352-46371374 AGTCTGAGGCCAGAGGCACTGGG - Intronic
1184806120 22:46796029-46796051 ACTCTGGAGCCAGACGCCCCGGG + Intronic
1184879936 22:47298282-47298304 AGGATGGGGCCAGAGGAAGCAGG - Intergenic
1185278374 22:49959647-49959669 AGTTGGGGGCCAGAGGGCCCAGG - Intergenic
1203281042 22_KI270734v1_random:131194-131216 GGTCTCGGGCCAGAGCCCACAGG - Intergenic
952924723 3:38312743-38312765 AGACTGGAGACAGAGGCAGCCGG + Intronic
953911665 3:46896392-46896414 AGGGTGGGGCCAGAGGCAGTGGG + Intronic
954117810 3:48476847-48476869 AGCCTGGGGCAGGAGGCAGCAGG + Intronic
954419250 3:50409969-50409991 AGACTGAGGCCAGAGGAGGCAGG + Intronic
957042102 3:75343610-75343632 GGTCTGAGGCAAGAGGCCCCCGG + Intergenic
957959048 3:87226747-87226769 AGTCTGGAGCCGGGGGCGGCAGG + Intergenic
959463019 3:106650395-106650417 AGTCTGTGGCCAAAGGCCCAAGG + Intergenic
961368909 3:126417907-126417929 AGTCTGGGGCCAAGGGCCATAGG - Intronic
962400774 3:135057090-135057112 ATTCTGGGAGCAGAGGCAGCAGG - Intronic
966741422 3:183238177-183238199 TGTGTTGGGCCACAGGCCGCAGG - Intronic
967867997 3:194205989-194206011 AGTCTGGGGACAGATGACACGGG + Intergenic
968107050 3:196008931-196008953 GGTCTGTGGCCAGAGCCCTCTGG + Intergenic
968481687 4:835807-835829 TGTCTGAGCCCAGAGGCCACTGG - Intergenic
968658065 4:1787132-1787154 AGGCTGCGGCCAGAGGCCCTTGG - Intergenic
968686177 4:1960439-1960461 AGTCTGGGAGCAGAGGCAGGAGG - Intronic
969449472 4:7264839-7264861 TGGCTGGAGCCAGAGGCCCCCGG + Intronic
969631884 4:8343737-8343759 AGTCTGGGGCCTGAGGAGGCAGG - Intergenic
969673069 4:8600433-8600455 AGTGTGGAGCCAGCGGCTGCGGG + Intronic
969706106 4:8792934-8792956 AGTCTGGGGCCAGGCGCTGCTGG + Intergenic
970001697 4:11371531-11371553 AGTCTGGAGCCAGAGGGCCTGGG - Intergenic
972947278 4:44271403-44271425 AGTCTGAGTCCAGAGCCCGCAGG - Intronic
975878888 4:78878065-78878087 AGTCTGGAGCCTGAGACCACTGG - Intronic
976759802 4:88536140-88536162 AGTCTGGGGCCAGTTGCTGGAGG - Intronic
977648046 4:99437074-99437096 ATTCTGGGGCCAGAACCCTCAGG + Intergenic
985778015 5:1855301-1855323 AGGCAGGAGCCAGAGGCAGCAGG + Intergenic
986757836 5:10854619-10854641 AGTCTGAGGCCTGTGGCAGCAGG - Intergenic
986927387 5:12772689-12772711 AGTCTGTGGCCAAAGGCCCGAGG - Intergenic
989408663 5:41091694-41091716 GGCCTGGAGCCTGAGGCCGCTGG - Intergenic
990488212 5:56279583-56279605 AGCCTGACGCCAGAGGCCGAGGG + Intergenic
992663565 5:78984785-78984807 AGGTTGGGGCGAGAAGCCGCCGG + Intronic
994018369 5:94994955-94994977 AGTCTGTGGCCAAAGGCCCAAGG - Intronic
997371281 5:133362601-133362623 GGTCTGGGGGCTGAGGCCTCTGG + Intronic
997651635 5:135526166-135526188 AGCCTGGGGACTGAGGCTGCTGG - Intergenic
998053210 5:139053578-139053600 AGGCTGGGGCCAGATACTGCAGG - Intronic
999177839 5:149644101-149644123 AGGCTGGGGCCAGATGCTTCGGG + Intergenic
999194821 5:149774737-149774759 AGTATAGGGCCAGAGGCAGGAGG - Intronic
1001133105 5:169080516-169080538 AGTCTGGTTCCAGAGCCTGCCGG + Intronic
1002157342 5:177293671-177293693 ATTCTGGGGCAAGAGGTGGCTGG + Intronic
1002198303 5:177512971-177512993 AGGCCGGGGCCAGAGTCCCCAGG - Intronic
1002633599 5:180596463-180596485 TGTCTAGAGCCAAAGGCCGCAGG + Intergenic
1002817215 6:692696-692718 AGTCTGGGGCCAGCTCCAGCGGG + Intronic
1004774104 6:18823159-18823181 AGGCTGGAGCCAGAGGGCCCAGG - Intergenic
1006651224 6:35553385-35553407 ACTCTGGGGCCAGATGGCCCGGG + Intergenic
1006665130 6:35688394-35688416 AGCCGGGGGCCAGAGACCGGAGG + Intronic
1007274660 6:40664389-40664411 CGTCTGGGGCCAGAGGCAGGTGG + Intergenic
1010642751 6:78350153-78350175 AGTCTGAGGCCAAAGGCCTAAGG + Intergenic
1012584384 6:100904505-100904527 AGTCTGGGTCCAAAGGCCTGAGG - Intergenic
1015316597 6:131824049-131824071 AGTCTGGTGCAAGAGGCTGGGGG + Intronic
1015626210 6:135182512-135182534 CGCCTGGGGGCAGAGCCCGCGGG - Intronic
1015642946 6:135356410-135356432 GGTCTGGGACCAGAGGGCACTGG + Intronic
1017724345 6:157266823-157266845 GGTCTGAGGGCAGAGGCGGCAGG - Intergenic
1019713936 7:2529856-2529878 AGGCTGCGGGCAGAGGCTGCTGG + Intergenic
1019755110 7:2763012-2763034 AGTCCTGGGCCAGTGGCCGGCGG - Intronic
1020920099 7:14252755-14252777 AGTCTGGGGCCAGAGTCCACTGG + Intronic
1021525537 7:21582917-21582939 TGACTGGGGCCAGAGAACGCCGG - Intronic
1023539819 7:41253115-41253137 ACCCTGGGGACAGAGGCCGGTGG + Intergenic
1027349250 7:77293689-77293711 AGTCTTAGGCCAGAGGCCTAAGG - Intronic
1029169164 7:98618386-98618408 AGTCTGGGGGCGGAGGTCGCAGG + Intronic
1029453565 7:100655987-100656009 AGTCTGGGGCCGGTGGGAGCTGG + Intronic
1029479840 7:100805646-100805668 AGTCTGGGGGCGGGGGCAGCCGG + Exonic
1029494449 7:100889593-100889615 GGTCTTGGGCCAGCTGCCGCAGG + Exonic
1029654770 7:101917009-101917031 AGGCTGGGGTCCGAGCCCGCGGG - Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1029739081 7:102481986-102482008 AGCCTGGAGCCAGTGGACGCTGG + Intergenic
1029757082 7:102581165-102581187 AGCCTGGAGCCAGTGGACGCTGG + Exonic
1029775023 7:102680226-102680248 AGCCTGGAGCCAGTGGACGCTGG + Intergenic
1037834886 8:22209929-22209951 AGGCCTGGGTCAGAGGCCGCAGG - Intronic
1037900322 8:22684409-22684431 AGCCTGGGGTCAGAGGCTGGTGG + Intergenic
1038061828 8:23922549-23922571 AGGCTGGCACCAGAGGCCCCAGG + Intergenic
1039858088 8:41433755-41433777 GGTCTGAGGCCAGAGGCCTGAGG - Intergenic
1045016359 8:98004663-98004685 AGACTGGGACAAGAGGCCGGAGG + Intronic
1046188019 8:110748516-110748538 AGTCTGTGGCCAAAGGCCCAAGG + Intergenic
1047667712 8:127110065-127110087 AGTCAGGGGCCACAGGTCTCAGG + Intergenic
1048112841 8:131487130-131487152 AGGCTGGCGCCAAAGGCCCCAGG + Intergenic
1048817663 8:138348970-138348992 AGTCTGGTGCCAGAGGGGCCTGG - Intronic
1049155769 8:141065889-141065911 AGTCTGGGGACACATGCCCCAGG - Intergenic
1049670891 8:143869413-143869435 AGGCCTGGGCCAGAGGCTGCTGG - Exonic
1050021139 9:1285718-1285740 ACTCTGGGGCCAGTGGCAGGCGG + Intergenic
1052471199 9:28899448-28899470 AGTCTGGAGCCTGGGGCCACTGG - Intergenic
1053007308 9:34612646-34612668 AGTCTGGGGGCTGAGGGGGCGGG + Intergenic
1057947951 9:99346116-99346138 AGTCTTGGGGCAGAGGGAGCAGG - Intergenic
1058351276 9:104027575-104027597 AGTTTGGTGCCAGAGGCAGAAGG + Intergenic
1061468238 9:130800543-130800565 TGTCTGGGGCCAGAGGCTGAGGG - Intronic
1061824877 9:133251948-133251970 AGGATGGGGCCCGAGGCTGCAGG + Intronic
1062007683 9:134249493-134249515 AGTCAGGGGCCTGAGGGAGCTGG - Intergenic
1062028708 9:134352369-134352391 AGTCTGGGGCATGAGGAAGCCGG + Intronic
1062038749 9:134394662-134394684 CCTCAGGGGCCAGAGGCCTCAGG + Intronic
1062177919 9:135174598-135174620 AGTCAGGGGCCAGCGGCAGAGGG - Intergenic
1062501178 9:136852683-136852705 AGTCTGGGACAAGAGGGCTCAGG + Intronic
1062549064 9:137077742-137077764 GCTCTGGGGGCAGGGGCCGCAGG - Exonic
1203760754 EBV:12290-12312 AATCTGGGCCCAATGGCCGCGGG - Intergenic
1203761683 EBV:15362-15384 AATCTGGGCCCAATGGCCGCGGG - Intergenic
1203762612 EBV:18434-18456 AATCTGGGCCCAATGGCCGCGGG - Intergenic
1203763541 EBV:21506-21528 AATCTGGGCCCAATGGCCGCGGG - Intergenic
1203764470 EBV:24578-24600 AATCTGGGCCCAATGGCCGCGGG - Intergenic
1203765399 EBV:27650-27672 AATCTGGGCCCAATGGCCGCGGG - Intergenic
1203766328 EBV:30722-30744 AATCTGGGCCCAATGGCCGCGGG - Intergenic
1203767257 EBV:33794-33816 AATCTGGGCCCAATGGCCGCGGG - Intergenic
1187414014 X:19076399-19076421 AGTCACAGGCCAGAGGCCCCAGG + Intronic
1192382720 X:70635449-70635471 AGTCTGGAGCCTGAATCCGCTGG - Intronic
1196525979 X:116727441-116727463 ATTCTGGGGTCAGAGGACGGTGG - Intergenic
1197784489 X:130186828-130186850 AGTCTGAGGCCAGAGGGGGATGG - Intergenic
1198285469 X:135185973-135185995 AGTCTGGGGCCATGGGCCATGGG - Intergenic
1198967672 X:142244678-142244700 GGTCTGGTGCCTGAGGCCACAGG - Intergenic
1199823636 X:151475972-151475994 AGTCTGAGGCCAAAGGCCTGAGG - Intergenic
1200142918 X:153910674-153910696 AGGCTGGGGCCTGAGGCTGGCGG - Intronic
1200211535 X:154348827-154348849 AGTCTGGGGCCCGTGCCAGCCGG - Exonic