ID: 1136231632

View in Genome Browser
Species Human (GRCh38)
Location 16:28888981-28889003
Sequence AGTCAGAAGGCTGCCTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136231622_1136231632 27 Left 1136231622 16:28888931-28888953 CCAACCAGATGTCTGTCTGCAAG 0: 1
1: 0
2: 4
3: 8
4: 163
Right 1136231632 16:28888981-28889003 AGTCAGAAGGCTGCCTGTGGGGG 0: 1
1: 0
2: 2
3: 23
4: 370
1136231624_1136231632 23 Left 1136231624 16:28888935-28888957 CCAGATGTCTGTCTGCAAGGTCA 0: 1
1: 0
2: 1
3: 10
4: 185
Right 1136231632 16:28888981-28889003 AGTCAGAAGGCTGCCTGTGGGGG 0: 1
1: 0
2: 2
3: 23
4: 370
1136231621_1136231632 30 Left 1136231621 16:28888928-28888950 CCACCAACCAGATGTCTGTCTGC 0: 1
1: 1
2: 0
3: 15
4: 173
Right 1136231632 16:28888981-28889003 AGTCAGAAGGCTGCCTGTGGGGG 0: 1
1: 0
2: 2
3: 23
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136231632 Original CRISPR AGTCAGAAGGCTGCCTGTGG GGG Intronic
900157899 1:1210913-1210935 AGGCCCAAGGCTGCCTGGGGTGG - Intergenic
900433529 1:2614500-2614522 AGTCAGAATGGTCCATGTGGTGG + Intronic
901837280 1:11932699-11932721 ATTCAGGAGGCTGACTGGGGAGG - Intergenic
902126214 1:14213791-14213813 AGTTATGAGGCTACCTGTGGTGG + Intergenic
902218647 1:14950544-14950566 AGTGAGAAGTCTGCCAGTGTAGG - Intronic
903273513 1:22206845-22206867 AGTCTGAATGCTGCCTCAGGGGG + Intergenic
903540344 1:24093095-24093117 CCTCAGTAGGCTCCCTGTGGAGG + Exonic
904050072 1:27633698-27633720 AGCCAGAAGGCTGGAAGTGGTGG - Intronic
905411285 1:37770355-37770377 AGTCAGAAGGCTGGATATGGTGG - Intergenic
905619279 1:39428260-39428282 GGTCAGCATGCTGCCTGTGCAGG - Exonic
908823598 1:68113090-68113112 AGAGAGAAGGCTTCCTGTGGTGG - Intronic
909711531 1:78655441-78655463 AGAAAGAAGGCGGCCTGTGCAGG + Exonic
910243352 1:85112202-85112224 AGCCAGATTGCTGCATGTGGTGG - Intronic
910643001 1:89484557-89484579 AGTCAGCATGTTGCCTGTGGTGG + Intergenic
912557255 1:110525151-110525173 GGTCAGCAGGCTGGGTGTGGGGG + Intergenic
912709131 1:111937330-111937352 AATCCTAATGCTGCCTGTGGAGG - Intronic
913280274 1:117178875-117178897 ATTCATAAGGCTGGGTGTGGTGG - Intronic
915072902 1:153287055-153287077 AGGCAGAAGCCTGCCTGGGATGG + Intergenic
915381727 1:155447515-155447537 AGTAACAAGGCTGAGTGTGGTGG - Intronic
916193744 1:162203965-162203987 AGGCTGAAGGGGGCCTGTGGTGG - Intronic
916403523 1:164474207-164474229 ATTTAGAAGGCTGGCCGTGGTGG - Intergenic
916518713 1:165544222-165544244 GATCCGAAGGCTGCCGGTGGGGG - Exonic
916834764 1:168532478-168532500 AGTCAGAGAGCTGACTGGGGTGG + Intergenic
917527773 1:175804268-175804290 AGACAGGAGGCTGGGTGTGGTGG + Intergenic
918071425 1:181135804-181135826 CTTCAGAATGCTGCCTGTGATGG + Intergenic
919747478 1:201017638-201017660 CAACAGAAGGCTGGCTGTGGAGG + Intronic
920003906 1:202818632-202818654 AGAAAGAAGGCTGGGTGTGGTGG + Intergenic
920322904 1:205138300-205138322 TGCCAGAAGGGTGGCTGTGGAGG + Intergenic
920369974 1:205472771-205472793 AGTCAGGAGGCTGGGGGTGGAGG + Intergenic
920394620 1:205635246-205635268 AGGCAGTAGGCTGGTTGTGGTGG + Intergenic
921128043 1:212195576-212195598 AGACAGAAGCCTGCTTATGGGGG + Intergenic
921384675 1:214556636-214556658 ACACAGGAGGCTGCCTCTGGCGG + Intergenic
921965367 1:221082548-221082570 AGCCAGATGCCTGCCTCTGGAGG + Intergenic
922605968 1:226890168-226890190 GGTCAGCAGGCAGCCTGTGGGGG + Intronic
923251524 1:232183180-232183202 AGTCAGAATGCTCTCAGTGGAGG + Intergenic
923760428 1:236837653-236837675 ACTCAGGAGGCTGAGTGTGGAGG + Intronic
924528253 1:244871071-244871093 AGTGAGCAGGCTGGGTGTGGTGG + Intergenic
924598307 1:245465919-245465941 AGCCAGAAGGAAGCCTGTCGAGG + Intronic
1063843316 10:10096542-10096564 AGTCAGAGGACTGCCTGAAGAGG - Intergenic
1063857552 10:10271960-10271982 AGTGAGAAGGCTATCTGTGCAGG + Intergenic
1065454520 10:25893007-25893029 AGACATAAGGCACCCTGTGGTGG + Intergenic
1065904712 10:30240028-30240050 ACTCAGGAGGCTGAGTGTGGAGG + Intergenic
1067084957 10:43233057-43233079 AGTGAGAAGGTGGCCTGTCGGGG - Intronic
1067413600 10:46086447-46086469 GGGCAGAAGGCTGGGTGTGGTGG - Intergenic
1067596110 10:47559413-47559435 AGTAAGGAGGCTGGATGTGGTGG - Intergenic
1067660360 10:48232834-48232856 AGGCAGAAGGCAGACTCTGGAGG - Intronic
1069670985 10:70203693-70203715 AGTTTGAAGGCTGGGTGTGGTGG - Intronic
1069843385 10:71354173-71354195 ACTCAGAAGCCTGCCTGGTGCGG - Intronic
1069955007 10:72044618-72044640 TGTCTGGAGGCTGCCCGTGGAGG - Intergenic
1069975313 10:72208115-72208137 ACTCGGAAGGCTGGGTGTGGTGG - Intronic
1071545880 10:86528971-86528993 AGTAAGCAGGCTGGGTGTGGTGG - Intergenic
1074361310 10:112825658-112825680 AGTCACCAGGGTGCCTGTGGGGG + Intergenic
1074470486 10:113722163-113722185 TCTCAGAAGGATGCCTGTGCAGG + Intronic
1074638648 10:115351357-115351379 AGTCAGTATGATGCCAGTGGTGG + Intronic
1074925177 10:118061660-118061682 AGTCTGAAGGTGGCCTGTGGAGG - Intergenic
1075807527 10:125200845-125200867 AATCTGAAGGCTGGATGTGGTGG + Intergenic
1076305978 10:129466301-129466323 AGGCAGAAGGCCGCTTGGGGAGG - Intergenic
1077060183 11:614462-614484 AGAGAGAAGGGTACCTGTGGTGG + Exonic
1077108977 11:853833-853855 GGGAAGCAGGCTGCCTGTGGTGG + Intronic
1077198545 11:1293634-1293656 AGGAAACAGGCTGCCTGTGGTGG + Intronic
1079361677 11:19775708-19775730 AGTCAGAAGTCTCCCTGAAGAGG + Intronic
1079711780 11:23693014-23693036 AGTCAGAAAACTGCCAATGGCGG - Intergenic
1080284772 11:30597495-30597517 AATCAGAAGGCTTGATGTGGTGG + Intergenic
1080306357 11:30840611-30840633 TGTGGGAAGGCAGCCTGTGGGGG + Intronic
1080372390 11:31666294-31666316 AATCTGAAGGCTGGGTGTGGTGG - Intronic
1081668492 11:44930307-44930329 AGGCAGGAGGCTGCCTTGGGAGG - Exonic
1083618424 11:64037252-64037274 AGGAAGGAGGCTGTCTGTGGGGG + Intronic
1084920258 11:72464032-72464054 AGTCATAAGACTCCCTGTGATGG + Intergenic
1085127350 11:74010868-74010890 AGTCCGAAGGCTGCCTGCTCTGG + Intergenic
1085321534 11:75577145-75577167 AATCAGAAGGCTGGGTGCGGTGG - Intergenic
1085565299 11:77508232-77508254 ATTCCCAAGGCAGCCTGTGGAGG - Intergenic
1086574014 11:88317252-88317274 AATAAGAAGGCTGGCCGTGGTGG - Intronic
1087202436 11:95359413-95359435 AAGCTGAAGGCTGCCTGTGTTGG + Intergenic
1087415689 11:97852590-97852612 AGTCAGCAGGTTGGGTGTGGTGG - Intergenic
1087814315 11:102641725-102641747 AGTGAGAAGGCCGGGTGTGGTGG + Intergenic
1090952851 11:131488648-131488670 AGTGAGAAGGCAGACTGTGGTGG - Intronic
1091256828 11:134195592-134195614 AGTGAAAAGGCTGGATGTGGTGG + Intronic
1093163860 12:15782390-15782412 ATTCAGAAGGCTGAATGGGGAGG + Intronic
1094569882 12:31632341-31632363 AGAAAGAAGGCTGGGTGTGGTGG - Intergenic
1095135493 12:38596326-38596348 ACTCACCAGACTGCCTGTGGAGG - Intergenic
1095799314 12:46255874-46255896 AGTCAAAGGGCTGGGTGTGGTGG + Intronic
1095964620 12:47858546-47858568 AGGCAGAAGCCTGCAGGTGGTGG - Intronic
1096129337 12:49145256-49145278 ACTCAGAAGGCTGGGCGTGGTGG - Intergenic
1097021151 12:56021589-56021611 AGGCAGAAGGCGGCTAGTGGAGG + Intronic
1098537555 12:71611174-71611196 AGTCAGTATTCTGCCAGTGGTGG - Intronic
1100462657 12:94816343-94816365 AGTCTGTAGGCTGCCTGCCGTGG - Intergenic
1101854225 12:108428658-108428680 AGTCAGTTGGCTGCCTTTGAGGG + Intergenic
1102954709 12:117052060-117052082 AGTTAGAGGGCTGGGTGTGGTGG - Intronic
1103368167 12:120398211-120398233 GGTCTGGAGCCTGCCTGTGGGGG + Intergenic
1103742782 12:123102574-123102596 AGTATGAGGGCTGCCTGTGGGGG - Intronic
1103852352 12:123941297-123941319 CCTCAGAAGTCTCCCTGTGGAGG - Intronic
1104440280 12:128788415-128788437 AGTCACATGGCTGGGTGTGGTGG + Intergenic
1106225521 13:27783429-27783451 AGTCAGGAGGCTGGATGTGATGG - Intergenic
1108355461 13:49625525-49625547 AGGCTGCAGGCTGCCTCTGGAGG - Intergenic
1109208342 13:59506186-59506208 AGGAAGAAGGCTGGGTGTGGTGG - Intergenic
1110863723 13:80371963-80371985 AGTCTGGAGGTTGCCTGTGTGGG - Intergenic
1113427421 13:110220669-110220691 AGTCAGAAGGAGGACGGTGGAGG - Intronic
1113834127 13:113317793-113317815 ACTCAGAAGGCTGACTAGGGAGG - Intronic
1114069391 14:19095782-19095804 AGGCAGAAAGCTGGCTGTTGAGG + Intergenic
1114092870 14:19304220-19304242 AGGCAGAAAGCTGGCTGTTGAGG - Intergenic
1114323138 14:21563705-21563727 ATTCAGAAGGCTGGGCGTGGTGG - Intergenic
1115695823 14:35897860-35897882 AGACAAAAGGCTGCCTGTCTGGG - Intronic
1115721414 14:36165174-36165196 AGTCAGAAGACTGGAAGTGGAGG + Intergenic
1116190588 14:41660311-41660333 AGTCATATGGCTGGGTGTGGTGG - Intronic
1119098312 14:71855060-71855082 AGGCAGAAGGCTGGGTGTAGTGG - Intergenic
1119972166 14:78983569-78983591 AGTGGGAAGGCTGGGTGTGGTGG + Intronic
1120683841 14:87513933-87513955 ACTCAGAAGGCTGAGTCTGGAGG + Intergenic
1122637193 14:103135705-103135727 AGTCATGAGGCCGACTGTGGAGG - Exonic
1123897540 15:24843358-24843380 ATTCAGAAGGCTGGTTGTGGTGG + Intronic
1124648553 15:31457894-31457916 AACCAGAAGGCACCCTGTGGGGG - Intergenic
1124944202 15:34247990-34248012 AGTCAGAGGGCTGGGTATGGTGG - Intronic
1125071923 15:35564809-35564831 GGACAGAAGGCTGGTTGTGGTGG - Intergenic
1127389435 15:58493266-58493288 AGACAGTAGGCAGGCTGTGGTGG - Intronic
1128413561 15:67423153-67423175 ATTCAGAACTCTCCCTGTGGTGG + Intronic
1129244168 15:74269669-74269691 AGTCAGAGGGCTGGGTGGGGTGG - Intronic
1132627067 16:896296-896318 ACTGTGAAGGCTGCCTCTGGCGG + Intronic
1133527257 16:6617647-6617669 AGTCAAAACCCTGCCTGTGATGG - Intronic
1134191822 16:12127528-12127550 ACTCAGAAGGCTGACGCTGGAGG - Intronic
1134477408 16:14587619-14587641 AATTAGAAGGCTGGGTGTGGTGG - Intronic
1135600596 16:23780070-23780092 AGATAGTAGGCTGGCTGTGGAGG + Intergenic
1135879326 16:26238860-26238882 AGGCAGAGGGCTGGGTGTGGTGG - Intergenic
1135981441 16:27150624-27150646 AGTCATAAGGCTGGGCGTGGTGG - Intergenic
1136231632 16:28888981-28889003 AGTCAGAAGGCTGCCTGTGGGGG + Intronic
1136536124 16:30900686-30900708 ACTCAGGAGGCTGAGTGTGGAGG + Intronic
1136577367 16:31132582-31132604 CGTCAGGAGGCTCACTGTGGGGG + Exonic
1137422762 16:48350096-48350118 AGTAAGGAGGCTGGGTGTGGTGG + Intronic
1137442998 16:48511913-48511935 AGTGAGAAGGGAGCCTGGGGTGG + Intergenic
1137747078 16:50830336-50830358 GGTCAGTAGGCTGCCTCTGGAGG - Intergenic
1138553722 16:57760498-57760520 CGTCAGAAGGCTTCCTGGAGAGG + Intronic
1138582621 16:57951462-57951484 ACTCAGAAGGCTGAGTGAGGTGG - Intronic
1138922327 16:61546678-61546700 AGACAGTAGGCTGGATGTGGTGG - Intergenic
1139276031 16:65728412-65728434 AGTCAGAAGGCTTCCAGGAGGGG + Intergenic
1139751905 16:69114052-69114074 TCTCAGGAGGCAGCCTGTGGTGG - Intronic
1140229924 16:73109060-73109082 AGTCCTCAGGCTGGCTGTGGAGG - Intergenic
1142785406 17:2218117-2218139 AGAGAGTAGGCTGTCTGTGGGGG - Intronic
1143302045 17:5917708-5917730 AGGGAGCAGGCTGCCTTTGGAGG + Intronic
1143658933 17:8312986-8313008 GCTCAGATGGGTGCCTGTGGGGG + Exonic
1143763607 17:9122319-9122341 ACTCAGAGGGCTGGGTGTGGTGG - Intronic
1144291108 17:13827218-13827240 AGTGGGAAGGCTGCCTTTGGAGG + Intergenic
1144945499 17:18967637-18967659 AGCTTGCAGGCTGCCTGTGGTGG + Intronic
1145043902 17:19597106-19597128 AATCAGGAGGCTGCTGGTGGGGG + Intergenic
1146115396 17:30133050-30133072 ACTCAGGAGGCTGACTGAGGTGG - Intronic
1146185213 17:30720140-30720162 AGCCAGAGGGCTGTGTGTGGAGG + Intergenic
1146319797 17:31838083-31838105 AGGCACAGGGCTGCCTGTGGTGG + Intergenic
1146453000 17:32989643-32989665 AGTCAGGTGGCTGGGTGTGGTGG + Intronic
1146698646 17:34933067-34933089 AGTCATAAGGCCGGGTGTGGTGG - Intronic
1146791283 17:35752116-35752138 AGGCAGAAGGCTGGGTGTGGTGG - Intronic
1147271291 17:39273538-39273560 AGTAACAAGGCTGGGTGTGGTGG + Intronic
1148271525 17:46265776-46265798 AATCAGAAGGTTGCCTGTTGAGG - Intergenic
1148849295 17:50547142-50547164 AGTCAGGAGGCTGCGAGGGGCGG - Exonic
1150115006 17:62539788-62539810 ATTAAGAAGGCTGGGTGTGGTGG - Intronic
1150625308 17:66837432-66837454 AGCCAGAAGGCTGTGTGGGGTGG - Intronic
1150765253 17:67997017-67997039 AATCAGAATGTTGCCTGTTGAGG + Intergenic
1152368971 17:79873425-79873447 ACTCAGAAGGCTGAGTGGGGAGG - Intergenic
1152795909 17:82306145-82306167 AGGCAGGAAGCTGCCTCTGGGGG - Intergenic
1152848276 17:82615872-82615894 AGTCTGAAGGCGGCAGGTGGTGG + Exonic
1153468984 18:5421809-5421831 ACTCAGAAGGCAGACAGTGGCGG + Intronic
1154995553 18:21637009-21637031 AGTCAGAGGGCTGGGCGTGGTGG + Intergenic
1155345134 18:24850153-24850175 AGGCAGAAGTCAGCCTGTGAAGG - Intergenic
1155781626 18:29844787-29844809 AGTCAGAATGGTGCCTGAAGAGG + Intergenic
1155792259 18:29988013-29988035 AGTCAAAAGGCAGGCTATGGTGG - Intergenic
1155965215 18:32029337-32029359 AGTCTGGAGGCTGGGTGTGGTGG + Intronic
1160700898 19:506855-506877 TGTCAGAAAGCTCCCTCTGGCGG + Intergenic
1161463774 19:4415715-4415737 TGTGAGAAGGCTGCCCGTGTTGG - Intronic
1161558668 19:4958413-4958435 AGGCAGAGGGCTGGCTGTGGGGG + Intronic
1162294853 19:9806318-9806340 ACTCAGTAGGCTGGGTGTGGTGG + Intergenic
1162554538 19:11378560-11378582 AGAATGATGGCTGCCTGTGGTGG - Exonic
1162678153 19:12316121-12316143 AATCTGAAGGCTGGGTGTGGTGG + Intergenic
1162723912 19:12678480-12678502 AGTAAGTAGGCTGGGTGTGGTGG + Intronic
1162973567 19:14195549-14195571 AGCCAGAGGGCTGTGTGTGGAGG - Intronic
1164025441 19:21347282-21347304 AGTCCAAAGGCTGGGTGTGGTGG - Intergenic
1166567450 19:43773963-43773985 AGACTGAAGGCTGCAGGTGGAGG + Intronic
1167805593 19:51781879-51781901 AGAGAGAAGGCTGGGTGTGGTGG + Intronic
1168265845 19:55223659-55223681 AGACATCAGGGTGCCTGTGGAGG - Intergenic
1168622945 19:57893487-57893509 AGTCAGTTGGCTGGGTGTGGTGG + Intronic
1168723626 19:58569180-58569202 AGTAAGAGGGCTGCCTGCGTAGG + Intronic
925103485 2:1269410-1269432 ACTCAGAAGGCTGAGTGGGGAGG + Intronic
925188599 2:1865841-1865863 AGTGAGCAGGCAGCGTGTGGAGG - Intronic
926655769 2:15404026-15404048 AATCAGAGGGCTGTGTGTGGTGG - Intronic
926720564 2:15957228-15957250 CTTCACAAGGCTCCCTGTGGTGG + Intergenic
926991563 2:18685968-18685990 GCTCAGAAAGCTGCCTGGGGTGG - Intergenic
928075421 2:28260181-28260203 ATTCAGAAGGCTGGGTGTGGTGG - Intronic
928211446 2:29326920-29326942 AGGCAGAATGGTGCCTGGGGTGG - Intronic
928487341 2:31746066-31746088 AGTAAAAAGGCTGACTTTGGAGG - Intergenic
929343365 2:40850298-40850320 AATAAGAAGGCTGGGTGTGGTGG - Intergenic
929778719 2:44944012-44944034 AGGCAGAAGGTTCCCGGTGGGGG + Intronic
929797087 2:45068499-45068521 AGTCAAATGGCTTCATGTGGGGG - Intergenic
930117237 2:47728773-47728795 ACTCAGAAGGCTGAGTGGGGAGG - Intronic
930417327 2:51104897-51104919 AGTTAGATGGCTGAGTGTGGTGG - Intergenic
930502907 2:52245298-52245320 AGACAGAATGATGGCTGTGGTGG - Intergenic
931848880 2:66233348-66233370 AGTCAGAAGTGAGCCTGTAGTGG + Intergenic
932398948 2:71466563-71466585 GGTCAGACGGGCGCCTGTGGGGG - Intronic
932400855 2:71480244-71480266 AATTAGAAGGCTGGATGTGGTGG + Intronic
933852017 2:86375678-86375700 ATTCTGATGGCTGACTGTGGTGG - Intergenic
935380563 2:102447217-102447239 AGTCAGAGGGCTGCATGTGGAGG - Intronic
937282674 2:120731067-120731089 AGTGAGGATGCTACCTGTGGGGG - Intergenic
937711207 2:124982233-124982255 ATTCACAAGGCTCCCTGTGATGG + Intergenic
937716987 2:125043526-125043548 AGTGATAAGGCTGGGTGTGGTGG + Intergenic
937774741 2:125763000-125763022 AGTCTGAGGGCTGGGTGTGGTGG + Intergenic
938923114 2:136013540-136013562 TGTCAGCTGGCTGGCTGTGGTGG - Intergenic
939804978 2:146764196-146764218 GGCCAGAAGGCTGACTATGGTGG + Intergenic
940687870 2:156876597-156876619 AGTCAGGAGGCTGAGTGGGGAGG + Intergenic
941920957 2:170850337-170850359 AGTCAGAGGCCTTCCTGAGGAGG + Intronic
942025058 2:171902459-171902481 ATTGAGAAGGCTGGGTGTGGTGG + Intronic
942349740 2:175039738-175039760 AGTCCGAAGAGTGCCTGAGGAGG + Intergenic
944715806 2:202375722-202375744 AGTCAGAGGGGAGCCTGAGGAGG + Intergenic
944974981 2:205039755-205039777 GGTCAGCAGGCTGAGTGTGGTGG - Intronic
947187386 2:227467280-227467302 AGGAAGGAGGCTGCCTGTGCAGG + Intergenic
947715696 2:232337923-232337945 AGACGGAAGGCCGCCTGAGGTGG - Intronic
947721231 2:232370300-232370322 AGACTGAAGGCCGCCTGAGGTGG - Intergenic
947734726 2:232448683-232448705 AGACTGAAGGCCGCCTGAGGTGG - Intergenic
947942908 2:234074374-234074396 ACTCAGAAAGCTGGCGGTGGTGG - Intronic
948862954 2:240761762-240761784 ACTCACAAGGCTGCTCGTGGCGG - Intronic
1169114535 20:3055048-3055070 AGGAAGGAGGCTGCGTGTGGTGG - Intergenic
1170574580 20:17652730-17652752 AGGCACAAGGCAGCCAGTGGGGG + Intronic
1171385903 20:24769439-24769461 AGTGAGAGGGAAGCCTGTGGCGG - Intergenic
1172318362 20:33974691-33974713 AATAAGAAGGCTGGGTGTGGTGG - Intergenic
1173986040 20:47262298-47262320 ATTCAGGATGCTGCCGGTGGTGG + Exonic
1174483356 20:50845991-50846013 AGTCGGAAAGCTGGCTGAGGGGG - Intronic
1174488060 20:50873591-50873613 AGCCAGAGGGCTGCCGCTGGTGG - Intronic
1175103781 20:56599566-56599588 ACTCAGAAGGCTGAGTGGGGAGG - Intergenic
1176239614 20:64069863-64069885 AGTCAGGAGGCTGCCTGGCCTGG + Intronic
1177765807 21:25456066-25456088 ACTCAGAAGGCTGAGTGGGGAGG + Intergenic
1180487862 22:15818345-15818367 AGGCAGAAAGCTGGCTGTTGAGG + Intergenic
1180650435 22:17371621-17371643 AGTCAAAATGGTGGCTGTGGTGG + Intronic
1181509855 22:23384310-23384332 AGTCAGAAACCTGGCAGTGGTGG + Intergenic
1182509974 22:30812139-30812161 AATGAGAAGGCTGGGTGTGGTGG - Intronic
1183432706 22:37775195-37775217 AGGTAGAAGACTGCCTTTGGAGG + Exonic
1183542330 22:38436642-38436664 TGTCAGAGGGCTGCCTGGTGAGG - Intronic
1183713211 22:39519075-39519097 AGTCACAAGGCTCCCAGTGGAGG - Intergenic
1184151026 22:42638643-42638665 AGGCAGAAGGTTGCCTGTGGAGG + Intronic
1185074341 22:48675308-48675330 ACTCAGGAGGCTTCCTGTGGCGG + Intronic
1185180536 22:49358279-49358301 AGCCCAGAGGCTGCCTGTGGCGG + Intergenic
949935968 3:9116168-9116190 AGTGAAAGGGCTGCCTGGGGAGG - Intronic
950061905 3:10078674-10078696 AGTCTGAAGGCTGGGCGTGGTGG + Intronic
950370818 3:12528609-12528631 ACTCAGGAGGCTGAGTGTGGAGG + Intronic
953502933 3:43455347-43455369 AGTCAGAGGTATGACTGTGGAGG + Intronic
953634806 3:44653754-44653776 TGGCAGAAGCTTGCCTGTGGAGG + Intronic
954899816 3:54008995-54009017 TATTAGAAGCCTGCCTGTGGAGG - Intergenic
955101370 3:55853237-55853259 ACTCAGGAGGCTGGGTGTGGTGG + Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
957139555 3:76335467-76335489 ACACAGAAGGCTGGGTGTGGTGG - Intronic
957355581 3:79081340-79081362 ACTCAGATGGCTGTCAGTGGTGG + Intronic
958999510 3:100946499-100946521 AGTTTGAAGGCTGGGTGTGGTGG + Intronic
959588752 3:108052665-108052687 AATGAGAAGGCTGGCCGTGGTGG + Intronic
960846197 3:122006474-122006496 AGTTAAAGGGCTGCCTGGGGGGG + Intronic
962644276 3:137420455-137420477 AACCAGAAGGCTGCCTGTCTGGG + Intergenic
963127511 3:141828936-141828958 AAACAGAGGGCTGCCTGGGGTGG + Intergenic
963819259 3:149869945-149869967 TGTGGGAAGGCTGACTGTGGAGG + Intronic
965209640 3:165768342-165768364 AGTCATAAGGCTGCCTTTCCAGG - Intergenic
967937354 3:194739588-194739610 AGACAGGAGGAAGCCTGTGGAGG + Intergenic
968983962 4:3865419-3865441 CGTCACAAGGCTTCCTGTGCAGG + Intergenic
969017242 4:4111640-4111662 AGTCAGAGGGATGCCTAAGGCGG + Intergenic
969368789 4:6717189-6717211 AATCAGAAAGCTGCTTGTCGAGG + Exonic
969763982 4:9213648-9213670 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969764591 4:9218395-9218417 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969765195 4:9223143-9223165 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969765806 4:9227887-9227909 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969766415 4:9232631-9232653 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
969767030 4:9237374-9237396 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969767637 4:9242121-9242143 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969768244 4:9246870-9246892 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969768847 4:9251620-9251642 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969769452 4:9256369-9256391 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969770069 4:9261115-9261137 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969770673 4:9265863-9265885 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969771288 4:9270610-9270632 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969771656 4:9323411-9323433 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969772269 4:9328156-9328178 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969772885 4:9332902-9332924 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969773502 4:9337649-9337671 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969774117 4:9342394-9342416 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969774732 4:9347139-9347161 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969775348 4:9351884-9351906 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969775962 4:9356629-9356651 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969776573 4:9361374-9361396 CATCAGAAGGCTTCCTGTGCCGG - Intronic
969777191 4:9366120-9366142 CATCAGAAGGCTTCCTGTGCCGG - Intergenic
971805401 4:31351898-31351920 AGTCAGAAGGAGGCCTCAGGAGG + Intergenic
972956525 4:44399242-44399264 AGGCAGACGTCTGACTGTGGGGG + Intronic
973320198 4:48802427-48802449 AGTCACACGGCTGGGTGTGGTGG + Intergenic
973980286 4:56303055-56303077 AGTCTGGAGGCTGGGTGTGGTGG + Intronic
975184899 4:71389971-71389993 AGTCAGAAGGTGCCCTTTGGAGG - Intronic
975495188 4:75029208-75029230 AGGAAGGAGGCTGCCTTTGGGGG - Intronic
980458296 4:133073333-133073355 AGGCAGAAGCCTGCCTGGGGAGG + Intergenic
981178768 4:141714528-141714550 AGGCAGAAGCCTGCCTGGGATGG - Intronic
981250861 4:142598885-142598907 AATCAGAGGGCTGCCTGTTTGGG + Intronic
981736500 4:147958112-147958134 AGCTAGATGCCTGCCTGTGGTGG - Intronic
983034602 4:162848253-162848275 AGCCAGAGGGCTGCCTGTCTGGG - Intergenic
987109747 5:14674466-14674488 AGATAGAAGGCTGGGTGTGGTGG + Intronic
988999272 5:36744199-36744221 TCTCAGGAGGCTCCCTGTGGTGG - Intergenic
990026101 5:51191535-51191557 ATTAAGAAGGCTGACTTTGGAGG - Intergenic
990322185 5:54640770-54640792 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
990972575 5:61525121-61525143 AGTCAGGAGGCAGCCTGTAGGGG + Intronic
991066346 5:62428762-62428784 ACTCAGGAGGCTGAGTGTGGAGG - Intronic
991463060 5:66879619-66879641 ACTCAGAAGGCTGACTTGGGAGG - Intronic
991907803 5:71529580-71529602 ACTCAGAAGGCTGAGTGGGGAGG + Intronic
992150110 5:73894533-73894555 AGTAATGAGGCTGCCTGGGGAGG - Exonic
992787980 5:80187995-80188017 AGGCAGAAGGCTGGGTGCGGTGG + Intronic
993248263 5:85480384-85480406 AGGAAGAAGGCTGGGTGTGGTGG - Intergenic
997853619 5:137354428-137354450 ACTGAGGAGGCTGCCTGGGGGGG - Intronic
997951362 5:138245091-138245113 AGCCAGGAGGCTGAATGTGGTGG - Intergenic
998344651 5:141451113-141451135 AATCATAAGGCTGGGTGTGGTGG - Intronic
999566005 5:152862742-152862764 CTTCAGAAGGCTGGGTGTGGTGG + Intergenic
1000945285 5:167415156-167415178 AGACAGAAATCTTCCTGTGGCGG - Intronic
1001200179 5:169708850-169708872 AGGAAGAAGGCTGGGTGTGGTGG - Intronic
1001848136 5:174939725-174939747 AGCCAGGAGGCTGGGTGTGGTGG - Intergenic
1002580566 5:180207670-180207692 CGTCGAAAGGCTGCCCGTGGCGG - Intronic
1002671115 5:180868162-180868184 AGTGAGAAGGCTGTGTGTGATGG - Intergenic
1002783280 6:383046-383068 AGCCAGCAGGCTGCCCCTGGTGG + Intergenic
1003643922 6:7899029-7899051 AGCCAGAGGGCTGCAGGTGGTGG + Intronic
1003897547 6:10622033-10622055 ACTGGGAAGGCTGCCTGTAGGGG - Intronic
1004014140 6:11717011-11717033 GGTCAGAAGGCTGGGTGCGGTGG - Intronic
1006236570 6:32638566-32638588 ACTCAGAAGGCTGCCGTGGGAGG + Intronic
1006406708 6:33849795-33849817 TGTCAGAGGAGTGCCTGTGGAGG + Intergenic
1006974413 6:38085063-38085085 AGTCAGCAGGTTGCCCATGGTGG + Intronic
1007230233 6:40343118-40343140 GGTCAGAAGGGTGACTGGGGAGG + Intergenic
1007971061 6:46052770-46052792 CCTCAAATGGCTGCCTGTGGAGG - Intronic
1008429474 6:51398697-51398719 GGACAGAAGGCTGCCTGTAGAGG + Intergenic
1008860886 6:56148843-56148865 ACTCAGAAGACAGCCTGTGAGGG - Intronic
1011197113 6:84792941-84792963 GGTCAGAAGGCTTAGTGTGGTGG + Intergenic
1011455931 6:87549065-87549087 AGTCAGGTGGCTGGGTGTGGTGG + Intronic
1011577005 6:88813247-88813269 AGTTAGTATGCAGCCTGTGGTGG - Intronic
1011577923 6:88825028-88825050 AGACAGAAGGCTGGGTGTGGTGG - Intronic
1011785935 6:90845090-90845112 TGCCAGTAGGCTCCCTGTGGAGG + Intergenic
1012187203 6:96233607-96233629 AGTTAGAAAGCTGGCTTTGGTGG - Intergenic
1015056011 6:128904200-128904222 AGTCAGAAAGCTGTCTTTTGAGG - Intronic
1015544968 6:134352361-134352383 AGTCACCAGGCAGCCTTTGGGGG - Intergenic
1015596939 6:134875011-134875033 AGTTAGAAGGCCGGGTGTGGTGG - Intergenic
1017630105 6:156388796-156388818 AGTCAGATGCCTTCCTGGGGTGG - Intergenic
1019558100 7:1642471-1642493 AGGCAGGGGGCTGCCTCTGGTGG - Intergenic
1019728485 7:2616648-2616670 AGAGAGGAGGCAGCCTGTGGGGG + Intergenic
1019960048 7:4451488-4451510 AGTATGAAGGCTGGGTGTGGTGG + Intergenic
1020213584 7:6172344-6172366 AGTCTGAAGGCTGCTGGTGCAGG - Intronic
1020252292 7:6479264-6479286 ACTCAGAAGGCTGAGTGGGGAGG - Intronic
1022726692 7:32987726-32987748 AGTCAGAGGACTGCTTGTGCCGG - Intronic
1024273557 7:47659899-47659921 ACTCAGGAAGCAGCCTGTGGTGG + Exonic
1024573386 7:50744028-50744050 CTTGAGAAGGCTGCATGTGGAGG - Intronic
1024980325 7:55152729-55152751 GGACAGAAGACTTCCTGTGGGGG + Intronic
1024986608 7:55199767-55199789 AGTGAGAGGGCTGGCTGTGCTGG - Intronic
1025046895 7:55699907-55699929 AGTCAGAGGACTGCTTGTGCCGG + Intergenic
1027168310 7:75851950-75851972 AGTCACAAGGATGCATCTGGAGG - Intronic
1028881371 7:95884109-95884131 TTTCAGAAGACTGACTGTGGAGG - Intronic
1029239164 7:99146291-99146313 AGTCAGGAGGTTGCTTCTGGAGG + Intergenic
1030806345 7:113924415-113924437 AATCTGAATGCTGCCTTTGGTGG - Intronic
1031101815 7:117490462-117490484 AGTCTGAAGGCAGTCTGTTGGGG + Intronic
1031235343 7:119168675-119168697 AGTCAGAGGTCTGCCTGTTTGGG - Intergenic
1032044723 7:128595441-128595463 ATTAAGAAGGCTGGGTGTGGTGG - Intergenic
1032929236 7:136647218-136647240 ACTCGGAAGTCTGGCTGTGGAGG + Intergenic
1033798071 7:144871095-144871117 AGAAAGAAGGCTGGGTGTGGTGG - Intergenic
1034486220 7:151365109-151365131 ATTTAGAAGGCTGGGTGTGGTGG - Intronic
1035703256 8:1653359-1653381 GGTCATAGGGCTTCCTGTGGCGG + Intronic
1035924585 8:3713514-3713536 AGGCAGATGTCTGGCTGTGGGGG - Intronic
1036672929 8:10805230-10805252 AGCCAGCAGGCTGTCTGTGCTGG - Intronic
1036988467 8:13564907-13564929 TGGCTGAAGGCTGCTTGTGGTGG - Intergenic
1037181339 8:16009722-16009744 AGTCAGTAGGCTAACTGTAGGGG - Intergenic
1039403692 8:37294686-37294708 AGTCAAGAGGCTGCGGGTGGTGG - Intergenic
1039478376 8:37853658-37853680 AGTCTGATGGCTGGGTGTGGTGG - Intergenic
1040029507 8:42811918-42811940 AGCCAGATGGCTGGGTGTGGTGG + Intergenic
1040029589 8:42812675-42812697 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
1040696832 8:50009708-50009730 ATGTACAAGGCTGCCTGTGGTGG + Intronic
1040906119 8:52471494-52471516 ACTCAGAAGGCTGCATTGGGAGG - Intergenic
1042856857 8:73276463-73276485 CATCAGAAGGCTGGGTGTGGTGG - Intergenic
1042906086 8:73773670-73773692 AGGCAGGAGGCTGAGTGTGGTGG - Intronic
1044262968 8:90148994-90149016 TGTGAGAAGGCTGTCTTTGGAGG - Intergenic
1045036378 8:98179523-98179545 AGTCATAAAGCTGACTGTTGGGG + Intergenic
1045046254 8:98281922-98281944 AGTCAGGAGGATACCTGTGATGG + Intronic
1047267410 8:123319237-123319259 ACTCAGCAGGCTGGATGTGGTGG - Intergenic
1047719776 8:127629004-127629026 ACTCACAAGGCTGGATGTGGTGG + Intergenic
1047740275 8:127801055-127801077 AGGCAGAAGTGAGCCTGTGGGGG + Intergenic
1048786960 8:138060840-138060862 AGACAAAAGGCTGAATGTGGGGG + Intergenic
1049383729 8:142330532-142330554 TGTCTGAAGGCTCCCTGTTGGGG - Intronic
1049630055 8:143648988-143649010 AGTCAGCTGGCTGGATGTGGTGG + Intronic
1049787924 8:144459998-144460020 ACGCAGAAGGCAGCATGTGGGGG + Intronic
1050276099 9:4002282-4002304 AGTCAGAAGGTTCCTTCTGGAGG - Intronic
1050352144 9:4750483-4750505 GGTGAGAAGGATGTCTGTGGAGG - Intergenic
1053129668 9:35607794-35607816 TGTTAGAAGGGTGCCTGTGAGGG - Intronic
1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG + Intronic
1056282143 9:85051934-85051956 AGTCATATCTCTGCCTGTGGTGG - Intergenic
1056336771 9:85578321-85578343 ACACATAAGGCTGGCTGTGGTGG + Intronic
1057591672 9:96378322-96378344 ACTCAGGAGGCTGACTTTGGAGG + Intronic
1057707565 9:97407491-97407513 AGTGACAAAGCTGCCTATGGTGG + Intergenic
1059281110 9:113135018-113135040 AGGGAGATGGCTGCCTGGGGTGG + Intergenic
1059709956 9:116858374-116858396 AATCAAAAGGCTTCCTGTGCTGG + Intronic
1060563175 9:124565139-124565161 AGTCAGAAGGCCAGGTGTGGAGG + Intronic
1061784871 9:133021596-133021618 AGACAGCAGGCTGGCTGTGGTGG + Intergenic
1062519853 9:136953122-136953144 AGTCATGAAGCTGCCTGTGCTGG - Intronic
1185722568 X:2394224-2394246 AGACAGCAGGCTCCCTGTGAAGG + Intronic
1186060253 X:5697714-5697736 AGTCTGAAGGCAGCATGTTGGGG + Intergenic
1186512732 X:10142569-10142591 AGTCAGGAGGCTCCCTGTACTGG + Exonic
1187376566 X:18760718-18760740 ACTCAGGAGGCTGACTGAGGTGG - Intronic
1192355846 X:70402717-70402739 AGTTAGGAGGCTGGCTGTGTAGG + Intronic
1195634284 X:107095723-107095745 ATTCAAAAGGCTGGGTGTGGTGG + Intronic
1195660543 X:107373691-107373713 AGAAAGAAGGCTGGGTGTGGTGG + Intergenic
1196187708 X:112762353-112762375 GCTCAGAAAGCTGCCTGGGGTGG + Intergenic
1200170875 X:154073563-154073585 AGTCAGGAGGCTGGGTGCGGTGG + Intronic
1200967458 Y:9110245-9110267 AGCAAGACAGCTGCCTGTGGTGG + Intergenic