ID: 1136236142

View in Genome Browser
Species Human (GRCh38)
Location 16:28914671-28914693
Sequence GGAGCTGATTCAGGAGATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136236142_1136236149 26 Left 1136236142 16:28914671-28914693 CCTGGATCTCCTGAATCAGCTCC 0: 1
1: 0
2: 2
3: 23
4: 290
Right 1136236149 16:28914720-28914742 CTCCTCGATCTCCTTTTCCATGG 0: 1
1: 1
2: 0
3: 22
4: 191
1136236142_1136236150 27 Left 1136236142 16:28914671-28914693 CCTGGATCTCCTGAATCAGCTCC 0: 1
1: 0
2: 2
3: 23
4: 290
Right 1136236150 16:28914721-28914743 TCCTCGATCTCCTTTTCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136236142 Original CRISPR GGAGCTGATTCAGGAGATCC AGG (reversed) Exonic