ID: 1136236144

View in Genome Browser
Species Human (GRCh38)
Location 16:28914680-28914702
Sequence GAGGGCCGAGGAGCTGATTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136236144_1136236150 18 Left 1136236144 16:28914680-28914702 CCTGAATCAGCTCCTCGGCCCTC 0: 1
1: 0
2: 0
3: 19
4: 157
Right 1136236150 16:28914721-28914743 TCCTCGATCTCCTTTTCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 140
1136236144_1136236149 17 Left 1136236144 16:28914680-28914702 CCTGAATCAGCTCCTCGGCCCTC 0: 1
1: 0
2: 0
3: 19
4: 157
Right 1136236149 16:28914720-28914742 CTCCTCGATCTCCTTTTCCATGG 0: 1
1: 1
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136236144 Original CRISPR GAGGGCCGAGGAGCTGATTC AGG (reversed) Exonic