ID: 1136236150

View in Genome Browser
Species Human (GRCh38)
Location 16:28914721-28914743
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136236146_1136236150 0 Left 1136236146 16:28914698-28914720 CCCTCAGCAGCTTCGCCTTCAGC 0: 1
1: 0
2: 0
3: 27
4: 278
Right 1136236150 16:28914721-28914743 TCCTCGATCTCCTTTTCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 140
1136236147_1136236150 -1 Left 1136236147 16:28914699-28914721 CCTCAGCAGCTTCGCCTTCAGCT 0: 1
1: 0
2: 2
3: 32
4: 273
Right 1136236150 16:28914721-28914743 TCCTCGATCTCCTTTTCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 140
1136236144_1136236150 18 Left 1136236144 16:28914680-28914702 CCTGAATCAGCTCCTCGGCCCTC 0: 1
1: 0
2: 0
3: 19
4: 157
Right 1136236150 16:28914721-28914743 TCCTCGATCTCCTTTTCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 140
1136236145_1136236150 6 Left 1136236145 16:28914692-28914714 CCTCGGCCCTCAGCAGCTTCGCC 0: 1
1: 0
2: 2
3: 27
4: 262
Right 1136236150 16:28914721-28914743 TCCTCGATCTCCTTTTCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 140
1136236142_1136236150 27 Left 1136236142 16:28914671-28914693 CCTGGATCTCCTGAATCAGCTCC 0: 1
1: 0
2: 2
3: 23
4: 290
Right 1136236150 16:28914721-28914743 TCCTCGATCTCCTTTTCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type