ID: 1136238248

View in Genome Browser
Species Human (GRCh38)
Location 16:28928048-28928070
Sequence CTTGACATGCGGAGTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136238243_1136238248 30 Left 1136238243 16:28927995-28928017 CCACTGAAGGCCATTGAACAGGG 0: 1
1: 0
2: 2
3: 16
4: 176
Right 1136238248 16:28928048-28928070 CTTGACATGCGGAGTGTAGATGG 0: 1
1: 0
2: 1
3: 6
4: 77
1136238246_1136238248 20 Left 1136238246 16:28928005-28928027 CCATTGAACAGGGGAAGCACATG 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1136238248 16:28928048-28928070 CTTGACATGCGGAGTGTAGATGG 0: 1
1: 0
2: 1
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136238248 Original CRISPR CTTGACATGCGGAGTGTAGA TGG Intronic
902638659 1:17751754-17751776 CTGGACATGGTGGGTGTAGAGGG - Intergenic
903508594 1:23856311-23856333 CTTGACAGGCTGAGTGTACAGGG - Intronic
916727889 1:167539765-167539787 CTTGACCAGCTGAGTGCAGAAGG + Intronic
1065107113 10:22400490-22400512 CTTGAAATACGGAGTGCAGGAGG + Intronic
1071935945 10:90530808-90530830 CTTGACATGTGGAGATTATAAGG - Intergenic
1075484660 10:122812520-122812542 CTTCACAAGTAGAGTGTAGAGGG + Intergenic
1076231003 10:128820067-128820089 CTTGACATGCGGAGATTATGGGG + Intergenic
1076798731 10:132811067-132811089 CCTGACATGGGGAGTGGGGATGG + Intronic
1080112331 11:28582050-28582072 CGAGAAATGCGGAGTGAAGAGGG - Intergenic
1092815614 12:12310150-12310172 CTTGAATTGGGGAGAGTAGAAGG + Intergenic
1094473669 12:30825271-30825293 CTTGGCATGCGGAGCTGAGAAGG - Intergenic
1100118656 12:91341787-91341809 CTTGACATGTGGAGGTTATAAGG + Intergenic
1101242022 12:102848386-102848408 CTAGAAAGGCTGAGTGTAGATGG + Intronic
1101242117 12:102848910-102848932 CTGGAGAGGCTGAGTGTAGACGG + Intronic
1105964681 13:25373194-25373216 TTTGACATGAGGAAGGTAGAGGG + Intronic
1106336741 13:28790350-28790372 TTTTACATGCAGAGTGTATAAGG - Intergenic
1110198653 13:72821303-72821325 ACTGACATGGGGAGAGTAGAGGG + Intronic
1112233135 13:97608801-97608823 CTTGACAAGCTGAGAGAAGAAGG + Intergenic
1117201871 14:53398620-53398642 CCTGAGATGGGGAGTGCAGAAGG + Intergenic
1117396327 14:55313822-55313844 CTTGACATGCGGAGATTATGGGG + Intronic
1124025431 15:25961237-25961259 CCTGCCATGTGGAGTGCAGATGG + Intergenic
1126499649 15:49331144-49331166 CTTGACATGCTGAAAGTAAAAGG + Intronic
1136238248 16:28928048-28928070 CTTGACATGCGGAGTGTAGATGG + Intronic
1138489846 16:57370399-57370421 CTGGACCTGGGGAGGGTAGAGGG + Intergenic
1139691050 16:68642397-68642419 CTTGCCATCCAGAGTGTGGAGGG - Intronic
1140810378 16:78571477-78571499 CTTGACATGTGGATTTTAAAGGG + Intronic
1147724881 17:42560892-42560914 CTTGAAAGGCTGAGTGTGGAGGG - Intergenic
1149009558 17:51841224-51841246 AATGACATGCGGACTGAAGATGG - Intronic
1159594919 18:70373567-70373589 CTCAACATGATGAGTGTAGATGG + Intergenic
1160858658 19:1228493-1228515 GTTGACATGCGGAGGGCAGTGGG + Exonic
1162791239 19:13064105-13064127 CTTGACATGTGGGGTATGGAGGG + Intronic
1163311639 19:16518598-16518620 CTTGACTTGCGAAGTGAAGCAGG - Exonic
1164658876 19:29944986-29945008 AGTGACATCCTGAGTGTAGAAGG + Intronic
1168477354 19:56686211-56686233 CTTAACAAGGGGAGCGTAGAAGG + Intergenic
927293377 2:21426035-21426057 GTTGACATGGGGAGTATAGATGG - Intergenic
927387896 2:22557394-22557416 CATGACATGCACAGTGTAAATGG - Intergenic
927874827 2:26648304-26648326 CTTGACATTCAGAGAGCAGAGGG + Intergenic
932991793 2:76796805-76796827 TTTGACAAGCTGAGTGAAGAAGG + Intronic
933345803 2:81084171-81084193 CTTGATATGAGGAGTGTAATTGG - Intergenic
936732469 2:115400809-115400831 ATTGACGTGGGGAGTGAAGATGG - Intronic
939236642 2:139502769-139502791 CTTGGAATGGGGAGGGTAGAAGG + Intergenic
1170758791 20:19230748-19230770 TGTGACATGCGGACTGTGGAAGG - Intronic
1175172079 20:57087825-57087847 CTTGACATGTGGAGGGTAGAAGG - Intergenic
1179340678 21:40505811-40505833 CTGGATATGGGGAGTGTAGTGGG - Intronic
1180798721 22:18621302-18621324 ATGGACATGGGGAGTGTAGTGGG + Intergenic
1181222993 22:21373960-21373982 ATGGACATGGGGAGTGTAGTGGG - Intergenic
1181255746 22:21561659-21561681 ATGGACATGGGGAGTGTAGTGGG + Intronic
1182414151 22:30210299-30210321 GTTGACATGCGGAGAGGAGGAGG + Intergenic
951934285 3:28004077-28004099 CATGAACTGAGGAGTGTAGAGGG + Intergenic
953919251 3:46940654-46940676 CTTCACATGCCAAGTGCAGAAGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
965272076 3:166629856-166629878 CTTGACCTGCAGAGTATAGACGG + Intergenic
970506975 4:16741711-16741733 GTTGGCATGGGGTGTGTAGAGGG - Intronic
970906423 4:21221612-21221634 CTTGACATGTGGAGATTATAGGG + Intronic
972015412 4:34236944-34236966 CTTGACATGTGGGGAGTATATGG + Intergenic
973754589 4:54062689-54062711 TTTGACATGAGGAATGTAGAAGG + Intronic
974534288 4:63154557-63154579 GTTGAAATGCTGAGTGTAGTAGG - Intergenic
979414409 4:120418194-120418216 CTTGACATGAAGAGTTTATAGGG - Intergenic
981870138 4:149475857-149475879 CTTGACATGAGCAGTTTTGATGG + Intergenic
982328014 4:154149567-154149589 CTTGACGTGCTGAGAGAAGAAGG - Intergenic
983224569 4:165073900-165073922 CTTGACGAGGGGAGTGTAGCGGG - Intergenic
990046102 5:51433823-51433845 CTTGACAAGAGCAGTGTACATGG - Intergenic
991292471 5:65045959-65045981 CTTGACAAGTGCAGTTTAGATGG - Intergenic
996550722 5:124727245-124727267 CTTGACTTGGGGAGAGGAGAGGG - Intronic
996856636 5:128015597-128015619 CTTGGCATCAGGTGTGTAGAGGG - Intergenic
1000038185 5:157464690-157464712 CTTGAGATGAAGAGTGTAGAAGG + Intronic
1001530700 5:172459460-172459482 ATTGAGGTGTGGAGTGTAGAAGG + Intergenic
1001806109 5:174588095-174588117 CTAAACATGCATAGTGTAGAAGG - Intergenic
1006146415 6:31962441-31962463 CTTGATGGGCGAAGTGTAGATGG - Exonic
1008138320 6:47802533-47802555 ATAGACATGCAGAGTTTAGAAGG - Intronic
1008552968 6:52650818-52650840 CCTGACATGAGGAGTGCAAAAGG + Intergenic
1013383678 6:109603056-109603078 CTTGACGAGCGGAGAGAAGAAGG - Intronic
1018701453 6:166430606-166430628 ATAGACCTGCGGAGTGGAGAAGG + Exonic
1020722977 7:11772709-11772731 CTTGCCAGGGGGAGGGTAGAAGG + Intronic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1024929480 7:54655081-54655103 CCTGGTATGCGGAGTGTTGATGG - Intergenic
1030380290 7:108803462-108803484 CTTGACATGCGGTGATTACAGGG - Intergenic
1034759375 7:153657195-153657217 CCTGACATGAGGAGTGTGGGTGG - Intergenic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1048892364 8:138959400-138959422 CAGGACATGAGGAGTGTGGAGGG + Intergenic
1055128856 9:72751638-72751660 CCTGTCATGTGGAATGTAGAAGG - Intronic
1055381337 9:75710190-75710212 CTTGAGTTGAGGAGTGGAGATGG - Intergenic
1057085906 9:92209797-92209819 TCTGACATGAGGAGTGTAGTTGG + Intergenic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1195327891 X:103772941-103772963 CTTAACCTGAGAAGTGTAGAAGG + Intergenic