ID: 1136238854

View in Genome Browser
Species Human (GRCh38)
Location 16:28932210-28932232
Sequence AAGGGTTGGAAGGACTCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136238848_1136238854 4 Left 1136238848 16:28932183-28932205 CCATTTTCTTATTTGTAAAATTC 0: 1
1: 1
2: 15
3: 226
4: 1776
Right 1136238854 16:28932210-28932232 AAGGGTTGGAAGGACTCTGCCGG 0: 1
1: 0
2: 2
3: 14
4: 168
1136238846_1136238854 17 Left 1136238846 16:28932170-28932192 CCTCTCTGAGCCTCCATTTTCTT 0: 4
1: 38
2: 279
3: 1232
4: 4472
Right 1136238854 16:28932210-28932232 AAGGGTTGGAAGGACTCTGCCGG 0: 1
1: 0
2: 2
3: 14
4: 168
1136238845_1136238854 18 Left 1136238845 16:28932169-28932191 CCCTCTCTGAGCCTCCATTTTCT 0: 3
1: 38
2: 136
3: 640
4: 2195
Right 1136238854 16:28932210-28932232 AAGGGTTGGAAGGACTCTGCCGG 0: 1
1: 0
2: 2
3: 14
4: 168
1136238847_1136238854 7 Left 1136238847 16:28932180-28932202 CCTCCATTTTCTTATTTGTAAAA 0: 2
1: 22
2: 225
3: 1368
4: 5788
Right 1136238854 16:28932210-28932232 AAGGGTTGGAAGGACTCTGCCGG 0: 1
1: 0
2: 2
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136238854 Original CRISPR AAGGGTTGGAAGGACTCTGC CGG Intronic
900652304 1:3735690-3735712 AGGGGTTGGAGGGAGGCTGCTGG + Exonic
907759291 1:57342188-57342210 AAGGGTTGGAAGGAAGTTCCAGG - Intronic
910337725 1:86154398-86154420 AAGGGCTGCAAGGCCTCTGGTGG + Intronic
910619644 1:89238704-89238726 AAGGGTTAGAAGCACTTTTCTGG - Intergenic
910725612 1:90335619-90335641 AAAGGTTGGAAGGAAACTTCAGG - Intergenic
915284422 1:154843718-154843740 AAGGGTGAGAAGGAGTCTCCGGG - Intronic
916022752 1:160808266-160808288 ATGGATTGGGAGCACTCTGCAGG - Intronic
916724072 1:167507310-167507332 ATGGGTTTGAAGGACTCTACAGG + Intronic
918211086 1:182351186-182351208 TAGGGTTGGAAGGACACACCTGG - Intergenic
918492390 1:185095167-185095189 AAGCGTTGGAAGGACTTTAATGG + Intronic
921232378 1:213086167-213086189 AGGTGTTGGAAGGACACTGTAGG + Intronic
1062768541 10:82802-82824 GAGGGCTGGAAGAACACTGCTGG + Intergenic
1069597590 10:69682397-69682419 AAGAGTGGGAAGGACCCTGCTGG + Intergenic
1069827197 10:71261562-71261584 AAGGGAGAGAAGGACTCAGCTGG + Intronic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1072979480 10:100087808-100087830 AAGGGTTGGAAGGAGACAGAAGG + Intergenic
1074643599 10:115417787-115417809 CAAGGTTGGCAGGGCTCTGCAGG - Intronic
1075794242 10:125107387-125107409 AAGGGCCCGAAGGACTCTGGGGG + Intronic
1076220142 10:128727331-128727353 AAGGGTAGGAGAGATTCTGCAGG - Intergenic
1078689333 11:13563216-13563238 ATAGGTGGGAAGAACTCTGCTGG - Intergenic
1084413676 11:69018142-69018164 GTGTGTGGGAAGGACTCTGCTGG - Intergenic
1085769574 11:79312780-79312802 AGGGGTTGGATCCACTCTGCAGG - Intronic
1086561943 11:88178113-88178135 AAGGGTGAGGATGACTCTGCCGG - Intergenic
1087973729 11:104517798-104517820 TTGGTTTGAAAGGACTCTGCAGG + Intergenic
1089098222 11:115937661-115937683 ATGGTTTGGAAGAACTCTGATGG + Intergenic
1089520615 11:119060525-119060547 AATGGATGGAAAGACTCTACTGG - Intergenic
1091073024 11:132586919-132586941 AAGGCTTGGGAGCCCTCTGCAGG + Intronic
1092945314 12:13449095-13449117 GAGAGGTGGAGGGACTCTGCAGG - Intergenic
1097080656 12:56428424-56428446 AAGGGATGGAAGGGCTATTCTGG + Intronic
1099136797 12:78915155-78915177 AAGGCAGGGAATGACTCTGCAGG + Intronic
1105448363 13:20476381-20476403 AAAGGCAGGAAGGTCTCTGCTGG + Intronic
1107019355 13:35735821-35735843 AAGGTTTGGAAGGGTCCTGCAGG + Intergenic
1108054717 13:46474200-46474222 AAGGGGAGGAAGGACCATGCAGG - Intergenic
1109138792 13:58687354-58687376 AAGGGATGGATGCACACTGCAGG - Intergenic
1111377372 13:87398244-87398266 AAGGATTTGAGGGCCTCTGCTGG - Intergenic
1115331286 14:32201472-32201494 AATCGTTGCAAGGACTCTCCCGG + Intergenic
1118454014 14:65929186-65929208 AAGGCTTTGAAGGCCTCTGGAGG + Intergenic
1121045055 14:90781781-90781803 AAGGGCTGGAAGTTCTCTGTGGG + Intronic
1121253519 14:92515874-92515896 TTGGGTTGGAAGGACTTTGAAGG + Intronic
1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG + Intronic
1122776939 14:104121551-104121573 AAGGGCTGGATGAACCCTGCAGG - Intergenic
1126339082 15:47619906-47619928 AAGCTTTGGAAGGTCTCTGAAGG - Intronic
1126376350 15:48000767-48000789 AAAGGTTTAAGGGACTCTGCAGG - Intergenic
1127477066 15:59344708-59344730 AAGAGTGGGAAGGACTTTGGTGG - Intronic
1127493291 15:59485049-59485071 AAGAGTGGGAAGGACTTTGGTGG + Intronic
1128301614 15:66569705-66569727 AAGGGCTGGAGGGAACCTGCCGG + Intergenic
1128604661 15:69027836-69027858 CAGGGCTGGAAGGAGCCTGCAGG + Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129228765 15:74184873-74184895 GAGGGAGGGAAGGGCTCTGCCGG - Intronic
1131370922 15:91881163-91881185 AAGGGTTGGAGGGACCAAGCTGG - Intronic
1131383230 15:91981514-91981536 ACAGGTAGGAAGCACTCTGCAGG - Intronic
1131450035 15:92531656-92531678 AAGGGTTGGCATGACCCAGCTGG - Intergenic
1136238854 16:28932210-28932232 AAGGGTTGGAAGGACTCTGCCGG + Intronic
1138590814 16:57998797-57998819 AAGGGTTGGCAGGAAGCTGGAGG - Intronic
1140045710 16:71439283-71439305 GAAGGATGGAAGGACTCAGCGGG + Intergenic
1140630131 16:76842132-76842154 AAGAGTTGGAAGCATTCTGCTGG - Intergenic
1142713886 17:1737709-1737731 AAGGGTGGGAAGACATCTGCGGG + Exonic
1143742917 17:8966792-8966814 AAGAGTTGGAAGGACTCCCCAGG + Intergenic
1145878271 17:28335888-28335910 AAGGGATGGACGGCCCCTGCTGG + Intronic
1146227052 17:31076154-31076176 AAGAGTATGAAGGACTCTGATGG + Intergenic
1148775734 17:50094983-50095005 AAGGGTTAAAAGGAGCCTGCAGG + Intronic
1148779002 17:50111267-50111289 TTGGGTTGGCCGGACTCTGCTGG - Exonic
1149503332 17:57172047-57172069 AAGGTTGGGCAGGGCTCTGCAGG - Intergenic
1151095357 17:71491184-71491206 CAGTATTGGAAGGACTCTGATGG - Intergenic
1154359529 18:13647839-13647861 GACAGTTGGAAGGCCTCTGCTGG + Exonic
1154375786 18:13808568-13808590 AAGGGCGTGAAAGACTCTGCTGG - Intergenic
1154379834 18:13838978-13839000 AAGGATGTGAAGGACGCTGCCGG + Intergenic
1157221704 18:45832847-45832869 GAGGGTGGGAAAGACTCAGCAGG - Intronic
1158760466 18:60379854-60379876 AAGGTTTGGAAGGAATGTCCTGG - Intergenic
1159637620 18:70824799-70824821 AAGGGTAGGAAGAACACTGTGGG - Intergenic
1163596053 19:18221453-18221475 AATGGTTGGAGGGGCTGTGCTGG - Intronic
1163658884 19:18564721-18564743 AAGAGTAGGTAGAACTCTGCAGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167565221 19:50251994-50252016 AAGGGTGGGAAGGGCTCTCCAGG + Intronic
925303247 2:2831873-2831895 GAGGGTCGAAAGGACTCAGCAGG + Intergenic
926929411 2:18022539-18022561 AAGGGTGGGAAGCACTCTAGTGG + Intronic
927718834 2:25370089-25370111 CAGGATTGGAAGGTCTCTGGGGG - Intergenic
931240972 2:60452422-60452444 CTAGGCTGGAAGGACTCTGCAGG + Intronic
931485669 2:62688909-62688931 AAGTTTTGGAATGACTCTTCTGG + Intronic
937022323 2:118668833-118668855 TAGGTTTGAAAGGGCTCTGCAGG + Intergenic
937436471 2:121885795-121885817 AAGGCTTGGATGGAGGCTGCAGG + Intergenic
938094203 2:128451133-128451155 ATGGGTAAGAAGGACTGTGCTGG + Intergenic
938185668 2:129229775-129229797 AAGGCTACGAAGGACTCTGTGGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939439412 2:142224704-142224726 AAAGGTAGGAAGGACTCTCAGGG + Intergenic
940433428 2:153621660-153621682 AAGAGTGGGAAGGACTGTGTTGG - Intergenic
940533428 2:154908216-154908238 AAGTTTTGGAAGGACTGGGCTGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942066635 2:172277662-172277684 AAGGATTGGAAGGACCCAACAGG + Intergenic
943188876 2:184650744-184650766 CAGAGTTGAAAGGTCTCTGCAGG + Intronic
1170154292 20:13255587-13255609 AAGGGAAGGAAAGACTTTGCAGG + Intronic
1171044303 20:21796217-21796239 AAGGGTTGGCAGAGCTCTCCAGG + Intergenic
1172247698 20:33457255-33457277 AAGGGTGGGAAGGACATGGCTGG - Intergenic
1173104122 20:40116159-40116181 TAGAGGTGGAAGGACTCTGATGG - Intergenic
1174368570 20:50071227-50071249 AAGGGTTGGAAGCGCACTGGGGG + Intergenic
1175654047 20:60753293-60753315 AAGGGGAGGAAGGACAGTGCTGG - Intergenic
1175773800 20:61640663-61640685 AAGAGTTGGCAGGAATTTGCTGG + Intronic
1177096296 21:16838037-16838059 AAGGGTAGCAATCACTCTGCAGG - Intergenic
1179891964 21:44339758-44339780 AATGCTTGTAAGGGCTCTGCTGG - Intergenic
1180061993 21:45390374-45390396 AGGGTTTGGAAGGCCTCTGCAGG - Intergenic
1180969173 22:19806092-19806114 CAGGGTTGGAAGGCATCAGCCGG - Intronic
1183345036 22:37302908-37302930 GGGGGCTGGAAGGGCTCTGCGGG + Intronic
1183425074 22:37734900-37734922 CAGGATTGTGAGGACTCTGCGGG - Exonic
1184465969 22:44668994-44669016 AGGGGTCGGACGGAATCTGCGGG + Intronic
1184847802 22:47099900-47099922 CAGGGCTGGAAGGGCTCTGAAGG - Intronic
949512703 3:4780801-4780823 CAGGGATGGAATGACTATGCAGG + Intronic
951860278 3:27244504-27244526 ATGGATTGGAGGGACACTGCAGG + Intronic
952286347 3:31973131-31973153 AAGGGTTGAAATGATTGTGCCGG - Intronic
952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG + Exonic
953791946 3:45954369-45954391 AGGGGTTGGGAGAACACTGCAGG - Intronic
955495202 3:59524128-59524150 AGGGGCTGGAAGAACACTGCTGG + Intergenic
957253172 3:77801215-77801237 AAGTGATGGAAGGATTCTTCAGG - Intergenic
960040355 3:113144094-113144116 TCAGGTTGGAAGGACTATGCAGG + Intergenic
966977325 3:185096594-185096616 GAGGGTGCGGAGGACTCTGCAGG + Intronic
977876332 4:102154916-102154938 AAGGGTAGGAATGTATCTGCTGG + Intergenic
978406271 4:108382364-108382386 CATGGTTGGAAGGATTCTGAAGG + Intergenic
987007327 5:13723973-13723995 AAGGGTTGTAATGAGTCTGTGGG + Intronic
991948335 5:71923361-71923383 AAGTGTTGGAAGGAGTATGAAGG + Intergenic
993656990 5:90590255-90590277 TAGGGTTTGAAGGACTTAGCTGG + Intronic
993896437 5:93541065-93541087 AAGGGTAGGACAGAATCTGCAGG - Intergenic
995681563 5:114726360-114726382 CAGGGTTGGAATGTCTCTGATGG - Intergenic
996328359 5:122302232-122302254 AAGGACTAGAAGGACTCTGTAGG + Intergenic
997751267 5:136348052-136348074 AAGAGTTGGAAGGCCTATGTAGG - Intronic
999672365 5:153969027-153969049 AAGAGTGGGCAGGACTCTCCAGG - Intergenic
1000894907 5:166843862-166843884 AAGGGTTGGGATGACACTGAGGG + Intergenic
1001828716 5:174767496-174767518 GAGAGTGGGAAAGACTCTGCTGG + Intergenic
1001970852 5:175953904-175953926 AAGGGTGGGTAGGAATCTGCTGG - Intronic
1002210570 5:177596533-177596555 AAGGAGAGGAAGGATTCTGCTGG + Intergenic
1002246586 5:177889860-177889882 AAGGGTGGGTAGGAATCTGCTGG + Intergenic
1002390811 5:178910331-178910353 AGGGGTTGGAAGAACTGTTCAGG - Intronic
1003387835 6:5685385-5685407 ATGGGTTGGAAGGACTGGACAGG - Intronic
1006927133 6:37663150-37663172 AAGGGATGGGAGGAATTTGCTGG - Intronic
1007391956 6:41554551-41554573 CAGTGTCTGAAGGACTCTGCAGG + Intronic
1007769834 6:44183774-44183796 AAGGGTGGGAAGGAATCTGCAGG + Intronic
1012861085 6:104560220-104560242 ATCGGTTGGAAGGACTCTAAAGG + Intergenic
1013615936 6:111843092-111843114 AACAGTTGGAATGACACTGCAGG + Intronic
1015353105 6:132246278-132246300 CAGCCTTGGAAGGATTCTGCTGG - Intergenic
1015966168 6:138696910-138696932 AAGGGTTGGCAGGACCCTGATGG - Intergenic
1017077604 6:150633311-150633333 ATGGGTTGGAAGGACCTGGCAGG + Intronic
1018323082 6:162634160-162634182 CAGGGTTGGAATGCATCTGCAGG + Intronic
1022212516 7:28225380-28225402 CAGGGTTTGGAGGACTCTGCAGG + Intergenic
1022329338 7:29362700-29362722 AAGGATTAGAAGGGTTCTGCAGG - Intronic
1022366908 7:29730412-29730434 AAGGGTGGGAAGGACTTTGGTGG - Intergenic
1023126370 7:36958448-36958470 GAGGGAGGGAAGGACTCTGGAGG - Intronic
1023222400 7:37932650-37932672 AAGGATGGGAAGGACAGTGCAGG - Intronic
1028986556 7:97013608-97013630 AAGGTGTGGAGAGACTCTGCTGG - Intergenic
1029312173 7:99677632-99677654 CAGGGTTTGGAGGACTCAGCAGG + Intronic
1033355338 7:140594581-140594603 AATAGTTGGAAGGACACAGCTGG - Intronic
1034174523 7:149090497-149090519 ACGGGTAGGACGGAGTCTGCAGG - Intronic
1034535803 7:151724969-151724991 CAGGGTTGGGAGGCCTCTCCTGG - Intronic
1034873646 7:154705933-154705955 AAGGGTTGGAAGGCCTGTGAAGG + Intronic
1035901047 8:3459020-3459042 AAGGGTAGGAAGGACCCGCCCGG + Intronic
1036513698 8:9423677-9423699 AAGAGCTGGAAGGACTTTGAGGG + Intergenic
1037568075 8:20134557-20134579 AAGGGATGGAAGGAGGCTTCTGG + Intergenic
1038427116 8:27470908-27470930 AATTGTAGGAAGGAGTCTGCAGG - Intronic
1038761614 8:30389375-30389397 AAGGGGTGGAAGTTCTCTTCTGG + Intronic
1039473229 8:37826562-37826584 AAGGACTCGAAGGACTCAGCCGG - Intronic
1040609787 8:48972809-48972831 ATGGCTTGGAAGGAATGTGCAGG - Intergenic
1042659207 8:71134991-71135013 AAGGGTAGGAATGAATCTGAGGG + Intergenic
1043080146 8:75755913-75755935 AAGAGTGGGAAGGACTTTGGTGG + Intergenic
1044225878 8:89717598-89717620 AAGGGCTGGAAGAAATTTGCTGG + Intergenic
1044590272 8:93907569-93907591 CAGAGTTGGAGGGACTCTGATGG + Intronic
1047219991 8:122911364-122911386 GAGGGTGTGAAGGCCTCTGCAGG - Intronic
1048579024 8:135715812-135715834 AGGGAGTGGAAGGGCTCTGCTGG + Intergenic
1050196101 9:3086185-3086207 AAGGATTGGAAGCCCTATGCGGG + Intergenic
1051102327 9:13535486-13535508 AATGGTTAGACGGGCTCTGCTGG + Intergenic
1053286024 9:36850055-36850077 AAGGGTGGGTAGGACTTTGATGG + Intronic
1055776250 9:79769842-79769864 AAGGGTGGGAAGACCTCAGCAGG - Intergenic
1057257743 9:93564095-93564117 CAGGGTTAGAAGGACCCAGCTGG + Intronic
1060347150 9:122827419-122827441 AAGGGTTTAAAGGACTATGATGG + Intronic
1061214376 9:129212554-129212576 AAGGATTAGAAGGGCCCTGCTGG + Intergenic
1186186174 X:7021958-7021980 AAGGGATGAAATGACTTTGCAGG - Intergenic
1186234968 X:7498052-7498074 AAGGGTAAGGAGGACACTGCAGG - Intergenic
1186287789 X:8064697-8064719 AAGGATTTGAGGGCCTCTGCCGG + Intergenic
1192218173 X:69178322-69178344 AAGGGCTGGAAACACTCTCCTGG + Intergenic
1192357518 X:70418098-70418120 AAGGGTTGGAAGAGCTGTGCAGG - Intronic
1193300430 X:79882003-79882025 AAGGGCTGGAAGGCCTCTGCTGG - Intergenic
1194673694 X:96767713-96767735 AATGGTGGGAAGGATTCAGCTGG + Intronic
1195021714 X:100834875-100834897 AAGGGTTGGAAGAACATTTCTGG + Intronic
1195516884 X:105787018-105787040 AAGGGATGGAACAACCCTGCTGG + Intergenic
1198773613 X:140156262-140156284 AAGAGTGGGAAGGACTGTGTCGG + Intergenic
1199613889 X:149640024-149640046 AATGGAAGGAAGGACACTGCTGG - Intergenic