ID: 1136241826

View in Genome Browser
Species Human (GRCh38)
Location 16:28949374-28949396
Sequence AGGCCAAGGCGGGGGCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136241814_1136241826 -1 Left 1136241814 16:28949352-28949374 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1136241826 16:28949374-28949396 AGGCCAAGGCGGGGGCGGAGGGG No data
1136241818_1136241826 -10 Left 1136241818 16:28949361-28949383 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 1136241826 16:28949374-28949396 AGGCCAAGGCGGGGGCGGAGGGG No data
1136241816_1136241826 -9 Left 1136241816 16:28949360-28949382 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1136241826 16:28949374-28949396 AGGCCAAGGCGGGGGCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136241826 Original CRISPR AGGCCAAGGCGGGGGCGGAG GGG Intergenic
No off target data available for this crispr