ID: 1136245504

View in Genome Browser
Species Human (GRCh38)
Location 16:28973748-28973770
Sequence GTGTTTCAGAACCTTAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136245504_1136245506 -7 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245506 16:28973764-28973786 GAAACACGAGGCACCTAATATGG No data
1136245504_1136245517 4 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245517 16:28973775-28973797 CACCTAATATGGGGGGGGGGGGG No data
1136245504_1136245515 2 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245515 16:28973773-28973795 GGCACCTAATATGGGGGGGGGGG No data
1136245504_1136245521 7 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245521 16:28973778-28973800 CTAATATGGGGGGGGGGGGGGGG No data
1136245504_1136245523 24 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245523 16:28973795-28973817 GGGGGGTTAAAGCCAATTATGGG No data
1136245504_1136245520 6 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245520 16:28973777-28973799 CCTAATATGGGGGGGGGGGGGGG No data
1136245504_1136245518 5 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245518 16:28973776-28973798 ACCTAATATGGGGGGGGGGGGGG No data
1136245504_1136245522 23 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245522 16:28973794-28973816 GGGGGGGTTAAAGCCAATTATGG No data
1136245504_1136245510 -3 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245510 16:28973768-28973790 CACGAGGCACCTAATATGGGGGG No data
1136245504_1136245508 -5 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245508 16:28973766-28973788 AACACGAGGCACCTAATATGGGG No data
1136245504_1136245513 0 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245513 16:28973771-28973793 GAGGCACCTAATATGGGGGGGGG No data
1136245504_1136245512 -1 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245512 16:28973770-28973792 CGAGGCACCTAATATGGGGGGGG No data
1136245504_1136245514 1 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245514 16:28973772-28973794 AGGCACCTAATATGGGGGGGGGG No data
1136245504_1136245516 3 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245516 16:28973774-28973796 GCACCTAATATGGGGGGGGGGGG No data
1136245504_1136245509 -4 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245509 16:28973767-28973789 ACACGAGGCACCTAATATGGGGG No data
1136245504_1136245511 -2 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245511 16:28973769-28973791 ACGAGGCACCTAATATGGGGGGG No data
1136245504_1136245507 -6 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245507 16:28973765-28973787 AAACACGAGGCACCTAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136245504 Original CRISPR GTGTTTCAGAACCTTAAGCT TGG (reversed) Intergenic
No off target data available for this crispr