ID: 1136245522

View in Genome Browser
Species Human (GRCh38)
Location 16:28973794-28973816
Sequence GGGGGGGTTAAAGCCAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136245519_1136245522 -6 Left 1136245519 16:28973777-28973799 CCTAATATGGGGGGGGGGGGGGG No data
Right 1136245522 16:28973794-28973816 GGGGGGGTTAAAGCCAATTATGG No data
1136245504_1136245522 23 Left 1136245504 16:28973748-28973770 CCAAGCTTAAGGTTCTGAAACAC No data
Right 1136245522 16:28973794-28973816 GGGGGGGTTAAAGCCAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136245522 Original CRISPR GGGGGGGTTAAAGCCAATTA TGG Intergenic
No off target data available for this crispr