ID: 1136247894

View in Genome Browser
Species Human (GRCh38)
Location 16:28985716-28985738
Sequence ATCTGAGGATGTGCTGTCGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136247894_1136247908 28 Left 1136247894 16:28985716-28985738 CCTACGACAGCACATCCTCAGAT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1136247908 16:28985767-28985789 CTCCCTCCACACCCCATGGCGGG 0: 1
1: 0
2: 3
3: 54
4: 550
1136247894_1136247897 3 Left 1136247894 16:28985716-28985738 CCTACGACAGCACATCCTCAGAT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1136247897 16:28985742-28985764 TGAGTCCGCCCCAGCCGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 172
1136247894_1136247906 24 Left 1136247894 16:28985716-28985738 CCTACGACAGCACATCCTCAGAT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1136247906 16:28985763-28985785 GGGTCTCCCTCCACACCCCATGG 0: 1
1: 0
2: 3
3: 33
4: 421
1136247894_1136247909 29 Left 1136247894 16:28985716-28985738 CCTACGACAGCACATCCTCAGAT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1136247909 16:28985768-28985790 TCCCTCCACACCCCATGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 183
1136247894_1136247907 27 Left 1136247894 16:28985716-28985738 CCTACGACAGCACATCCTCAGAT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1136247907 16:28985766-28985788 TCTCCCTCCACACCCCATGGCGG 0: 1
1: 0
2: 3
3: 40
4: 255
1136247894_1136247898 4 Left 1136247894 16:28985716-28985738 CCTACGACAGCACATCCTCAGAT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1136247898 16:28985743-28985765 GAGTCCGCCCCAGCCGCCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136247894 Original CRISPR ATCTGAGGATGTGCTGTCGT AGG (reversed) Exonic