ID: 1136249311

View in Genome Browser
Species Human (GRCh38)
Location 16:28993515-28993537
Sequence TACAATAATCAGAATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136249311_1136249315 3 Left 1136249311 16:28993515-28993537 CCGTCCTCATTCTGATTATTGTA No data
Right 1136249315 16:28993541-28993563 AGTGCTGACTGCCCTGAATGGGG No data
1136249311_1136249320 26 Left 1136249311 16:28993515-28993537 CCGTCCTCATTCTGATTATTGTA No data
Right 1136249320 16:28993564-28993586 AAGCTCAGAAGAGGCCCAGGTGG No data
1136249311_1136249314 2 Left 1136249311 16:28993515-28993537 CCGTCCTCATTCTGATTATTGTA No data
Right 1136249314 16:28993540-28993562 AAGTGCTGACTGCCCTGAATGGG No data
1136249311_1136249318 17 Left 1136249311 16:28993515-28993537 CCGTCCTCATTCTGATTATTGTA No data
Right 1136249318 16:28993555-28993577 TGAATGGGGAAGCTCAGAAGAGG No data
1136249311_1136249319 23 Left 1136249311 16:28993515-28993537 CCGTCCTCATTCTGATTATTGTA No data
Right 1136249319 16:28993561-28993583 GGGAAGCTCAGAAGAGGCCCAGG No data
1136249311_1136249313 1 Left 1136249311 16:28993515-28993537 CCGTCCTCATTCTGATTATTGTA No data
Right 1136249313 16:28993539-28993561 AAAGTGCTGACTGCCCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136249311 Original CRISPR TACAATAATCAGAATGAGGA CGG (reversed) Intergenic
No off target data available for this crispr