ID: 1136251359

View in Genome Browser
Species Human (GRCh38)
Location 16:29007603-29007625
Sequence CCTGGGAGGCGGAGCCTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136251352_1136251359 16 Left 1136251352 16:29007564-29007586 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG No data
1136251348_1136251359 25 Left 1136251348 16:29007555-29007577 CCTGCAATCCCAGCTACTCGGGA 0: 856
1: 48852
2: 214053
3: 256126
4: 189793
Right 1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG No data
1136251350_1136251359 17 Left 1136251350 16:29007563-29007585 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136251359 Original CRISPR CCTGGGAGGCGGAGCCTAGA TGG Intergenic
No off target data available for this crispr