ID: 1136253419

View in Genome Browser
Species Human (GRCh38)
Location 16:29022579-29022601
Sequence TCAGATGAGTGGGGAAAATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136253419_1136253427 21 Left 1136253419 16:29022579-29022601 CCGTATTTTCCCCACTCATCTGA No data
Right 1136253427 16:29022623-29022645 AAATTCTCTTGGGCTGTTTCTGG No data
1136253419_1136253425 11 Left 1136253419 16:29022579-29022601 CCGTATTTTCCCCACTCATCTGA No data
Right 1136253425 16:29022613-29022635 ATCCTATGCTAAATTCTCTTGGG No data
1136253419_1136253424 10 Left 1136253419 16:29022579-29022601 CCGTATTTTCCCCACTCATCTGA No data
Right 1136253424 16:29022612-29022634 TATCCTATGCTAAATTCTCTTGG No data
1136253419_1136253428 30 Left 1136253419 16:29022579-29022601 CCGTATTTTCCCCACTCATCTGA No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136253419 Original CRISPR TCAGATGAGTGGGGAAAATA CGG (reversed) Intergenic
No off target data available for this crispr