ID: 1136253423

View in Genome Browser
Species Human (GRCh38)
Location 16:29022609-29022631
Sequence AGAGAATTTAGCATAGGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136253423_1136253427 -9 Left 1136253423 16:29022609-29022631 CCTTATCCTATGCTAAATTCTCT No data
Right 1136253427 16:29022623-29022645 AAATTCTCTTGGGCTGTTTCTGG No data
1136253423_1136253428 0 Left 1136253423 16:29022609-29022631 CCTTATCCTATGCTAAATTCTCT No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data
1136253423_1136253429 30 Left 1136253423 16:29022609-29022631 CCTTATCCTATGCTAAATTCTCT No data
Right 1136253429 16:29022662-29022684 TGCTAACTGCTGTCTATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136253423 Original CRISPR AGAGAATTTAGCATAGGATA AGG (reversed) Intergenic