ID: 1136253425

View in Genome Browser
Species Human (GRCh38)
Location 16:29022613-29022635
Sequence ATCCTATGCTAAATTCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136253419_1136253425 11 Left 1136253419 16:29022579-29022601 CCGTATTTTCCCCACTCATCTGA No data
Right 1136253425 16:29022613-29022635 ATCCTATGCTAAATTCTCTTGGG No data
1136253420_1136253425 2 Left 1136253420 16:29022588-29022610 CCCCACTCATCTGAAAAAGTGCC No data
Right 1136253425 16:29022613-29022635 ATCCTATGCTAAATTCTCTTGGG No data
1136253421_1136253425 1 Left 1136253421 16:29022589-29022611 CCCACTCATCTGAAAAAGTGCCT No data
Right 1136253425 16:29022613-29022635 ATCCTATGCTAAATTCTCTTGGG No data
1136253422_1136253425 0 Left 1136253422 16:29022590-29022612 CCACTCATCTGAAAAAGTGCCTT No data
Right 1136253425 16:29022613-29022635 ATCCTATGCTAAATTCTCTTGGG No data
1136253418_1136253425 28 Left 1136253418 16:29022562-29022584 CCAATTTATTGCATAATCCGTAT No data
Right 1136253425 16:29022613-29022635 ATCCTATGCTAAATTCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136253425 Original CRISPR ATCCTATGCTAAATTCTCTT GGG Intergenic