ID: 1136253426

View in Genome Browser
Species Human (GRCh38)
Location 16:29022615-29022637
Sequence AGCCCAAGAGAATTTAGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136253426_1136253429 24 Left 1136253426 16:29022615-29022637 CCTATGCTAAATTCTCTTGGGCT No data
Right 1136253429 16:29022662-29022684 TGCTAACTGCTGTCTATTCATGG No data
1136253426_1136253428 -6 Left 1136253426 16:29022615-29022637 CCTATGCTAAATTCTCTTGGGCT No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data
1136253426_1136253430 25 Left 1136253426 16:29022615-29022637 CCTATGCTAAATTCTCTTGGGCT No data
Right 1136253430 16:29022663-29022685 GCTAACTGCTGTCTATTCATGGG No data
1136253426_1136253431 26 Left 1136253426 16:29022615-29022637 CCTATGCTAAATTCTCTTGGGCT No data
Right 1136253431 16:29022664-29022686 CTAACTGCTGTCTATTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136253426 Original CRISPR AGCCCAAGAGAATTTAGCAT AGG (reversed) Intergenic
No off target data available for this crispr