ID: 1136253427

View in Genome Browser
Species Human (GRCh38)
Location 16:29022623-29022645
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136253423_1136253427 -9 Left 1136253423 16:29022609-29022631 CCTTATCCTATGCTAAATTCTCT No data
Right 1136253427 16:29022623-29022645 AAATTCTCTTGGGCTGTTTCTGG No data
1136253420_1136253427 12 Left 1136253420 16:29022588-29022610 CCCCACTCATCTGAAAAAGTGCC No data
Right 1136253427 16:29022623-29022645 AAATTCTCTTGGGCTGTTTCTGG No data
1136253422_1136253427 10 Left 1136253422 16:29022590-29022612 CCACTCATCTGAAAAAGTGCCTT No data
Right 1136253427 16:29022623-29022645 AAATTCTCTTGGGCTGTTTCTGG No data
1136253421_1136253427 11 Left 1136253421 16:29022589-29022611 CCCACTCATCTGAAAAAGTGCCT No data
Right 1136253427 16:29022623-29022645 AAATTCTCTTGGGCTGTTTCTGG No data
1136253419_1136253427 21 Left 1136253419 16:29022579-29022601 CCGTATTTTCCCCACTCATCTGA No data
Right 1136253427 16:29022623-29022645 AAATTCTCTTGGGCTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136253427 Original CRISPR AAATTCTCTTGGGCTGTTTC TGG Intergenic