ID: 1136253428

View in Genome Browser
Species Human (GRCh38)
Location 16:29022632-29022654
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136253421_1136253428 20 Left 1136253421 16:29022589-29022611 CCCACTCATCTGAAAAAGTGCCT No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data
1136253422_1136253428 19 Left 1136253422 16:29022590-29022612 CCACTCATCTGAAAAAGTGCCTT No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data
1136253426_1136253428 -6 Left 1136253426 16:29022615-29022637 CCTATGCTAAATTCTCTTGGGCT No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data
1136253419_1136253428 30 Left 1136253419 16:29022579-29022601 CCGTATTTTCCCCACTCATCTGA No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data
1136253423_1136253428 0 Left 1136253423 16:29022609-29022631 CCTTATCCTATGCTAAATTCTCT No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data
1136253420_1136253428 21 Left 1136253420 16:29022588-29022610 CCCCACTCATCTGAAAAAGTGCC No data
Right 1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136253428 Original CRISPR TGGGCTGTTTCTGGATTTGC TGG Intergenic