ID: 1136254402

View in Genome Browser
Species Human (GRCh38)
Location 16:29028738-29028760
Sequence CAGGGACCACCCTCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136254402_1136254405 -7 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254405 16:29028754-29028776 GTCCCTGCTTACCATTCTCAGGG No data
1136254402_1136254404 -8 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254404 16:29028753-29028775 GGTCCCTGCTTACCATTCTCAGG No data
1136254402_1136254412 5 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254412 16:29028766-29028788 CATTCTCAGGGGCTCTGGCTGGG No data
1136254402_1136254420 28 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254420 16:29028789-29028811 CTGGGCGGAAGGGGCAGGACAGG No data
1136254402_1136254413 9 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254413 16:29028770-29028792 CTCAGGGGCTCTGGCTGGGCTGG No data
1136254402_1136254411 4 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254411 16:29028765-29028787 CCATTCTCAGGGGCTCTGGCTGG No data
1136254402_1136254406 -6 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254406 16:29028755-29028777 TCCCTGCTTACCATTCTCAGGGG No data
1136254402_1136254409 0 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254409 16:29028761-29028783 CTTACCATTCTCAGGGGCTCTGG No data
1136254402_1136254415 13 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254415 16:29028774-29028796 GGGGCTCTGGCTGGGCTGGGCGG No data
1136254402_1136254419 23 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254419 16:29028784-29028806 CTGGGCTGGGCGGAAGGGGCAGG No data
1136254402_1136254418 19 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254418 16:29028780-29028802 CTGGCTGGGCTGGGCGGAAGGGG No data
1136254402_1136254416 17 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254416 16:29028778-29028800 CTCTGGCTGGGCTGGGCGGAAGG No data
1136254402_1136254417 18 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254417 16:29028779-29028801 TCTGGCTGGGCTGGGCGGAAGGG No data
1136254402_1136254414 10 Left 1136254402 16:29028738-29028760 CCTTCCTCAGAGGGTGGTCCCTG No data
Right 1136254414 16:29028771-29028793 TCAGGGGCTCTGGCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136254402 Original CRISPR CAGGGACCACCCTCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr