ID: 1136267473

View in Genome Browser
Species Human (GRCh38)
Location 16:29130104-29130126
Sequence CCCGGTAGACACTCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136267473_1136267490 14 Left 1136267473 16:29130104-29130126 CCCTCCCCAGAGTGTCTACCGGG No data
Right 1136267490 16:29130141-29130163 CAGCATGCACGTCACCCGGGGGG No data
1136267473_1136267482 -9 Left 1136267473 16:29130104-29130126 CCCTCCCCAGAGTGTCTACCGGG No data
Right 1136267482 16:29130118-29130140 TCTACCGGGGGCACAGGCCCTGG No data
1136267473_1136267487 11 Left 1136267473 16:29130104-29130126 CCCTCCCCAGAGTGTCTACCGGG No data
Right 1136267487 16:29130138-29130160 TGGCAGCATGCACGTCACCCGGG No data
1136267473_1136267488 12 Left 1136267473 16:29130104-29130126 CCCTCCCCAGAGTGTCTACCGGG No data
Right 1136267488 16:29130139-29130161 GGCAGCATGCACGTCACCCGGGG No data
1136267473_1136267486 10 Left 1136267473 16:29130104-29130126 CCCTCCCCAGAGTGTCTACCGGG No data
Right 1136267486 16:29130137-29130159 CTGGCAGCATGCACGTCACCCGG No data
1136267473_1136267489 13 Left 1136267473 16:29130104-29130126 CCCTCCCCAGAGTGTCTACCGGG No data
Right 1136267489 16:29130140-29130162 GCAGCATGCACGTCACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136267473 Original CRISPR CCCGGTAGACACTCTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr