ID: 1136269203

View in Genome Browser
Species Human (GRCh38)
Location 16:29138559-29138581
Sequence CCCCTTTGCTCCCCTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136269203_1136269210 -5 Left 1136269203 16:29138559-29138581 CCTGCTTCAGGGGAGCAAAGGGG No data
Right 1136269210 16:29138577-29138599 AGGGGGCTGCTGGGGTGCTCGGG No data
1136269203_1136269214 19 Left 1136269203 16:29138559-29138581 CCTGCTTCAGGGGAGCAAAGGGG No data
Right 1136269214 16:29138601-29138623 TGTGGGAGGTGCCCATCAGAAGG No data
1136269203_1136269211 1 Left 1136269203 16:29138559-29138581 CCTGCTTCAGGGGAGCAAAGGGG No data
Right 1136269211 16:29138583-29138605 CTGCTGGGGTGCTCGGGCTGTGG No data
1136269203_1136269212 2 Left 1136269203 16:29138559-29138581 CCTGCTTCAGGGGAGCAAAGGGG No data
Right 1136269212 16:29138584-29138606 TGCTGGGGTGCTCGGGCTGTGGG No data
1136269203_1136269209 -6 Left 1136269203 16:29138559-29138581 CCTGCTTCAGGGGAGCAAAGGGG No data
Right 1136269209 16:29138576-29138598 AAGGGGGCTGCTGGGGTGCTCGG No data
1136269203_1136269213 5 Left 1136269203 16:29138559-29138581 CCTGCTTCAGGGGAGCAAAGGGG No data
Right 1136269213 16:29138587-29138609 TGGGGTGCTCGGGCTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136269203 Original CRISPR CCCCTTTGCTCCCCTGAAGC AGG (reversed) Intergenic
No off target data available for this crispr