ID: 1136269328

View in Genome Browser
Species Human (GRCh38)
Location 16:29139243-29139265
Sequence CAGGCTCAGCAAGGGGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136269328_1136269342 24 Left 1136269328 16:29139243-29139265 CCAGTGCCCCCTTGCTGAGCCTG No data
Right 1136269342 16:29139290-29139312 TCCAGGGGAACCCCCACCAAGGG No data
1136269328_1136269340 9 Left 1136269328 16:29139243-29139265 CCAGTGCCCCCTTGCTGAGCCTG No data
Right 1136269340 16:29139275-29139297 CTGAGTGTTAAACTCTCCAGGGG No data
1136269328_1136269341 23 Left 1136269328 16:29139243-29139265 CCAGTGCCCCCTTGCTGAGCCTG No data
Right 1136269341 16:29139289-29139311 CTCCAGGGGAACCCCCACCAAGG No data
1136269328_1136269338 7 Left 1136269328 16:29139243-29139265 CCAGTGCCCCCTTGCTGAGCCTG No data
Right 1136269338 16:29139273-29139295 GTCTGAGTGTTAAACTCTCCAGG No data
1136269328_1136269339 8 Left 1136269328 16:29139243-29139265 CCAGTGCCCCCTTGCTGAGCCTG No data
Right 1136269339 16:29139274-29139296 TCTGAGTGTTAAACTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136269328 Original CRISPR CAGGCTCAGCAAGGGGGCAC TGG (reversed) Intergenic
No off target data available for this crispr