ID: 1136270290

View in Genome Browser
Species Human (GRCh38)
Location 16:29144447-29144469
Sequence GGTGAATCACGAGCAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136270290_1136270299 7 Left 1136270290 16:29144447-29144469 CCTCTCCCTGCTCGTGATTCACC No data
Right 1136270299 16:29144477-29144499 CTCAGCACAGGGATTCCTGAAGG No data
1136270290_1136270297 -4 Left 1136270290 16:29144447-29144469 CCTCTCCCTGCTCGTGATTCACC No data
Right 1136270297 16:29144466-29144488 CACCTATGGGGCTCAGCACAGGG No data
1136270290_1136270301 28 Left 1136270290 16:29144447-29144469 CCTCTCCCTGCTCGTGATTCACC No data
Right 1136270301 16:29144498-29144520 GGAATTTTTCTCCATCCGAGAGG No data
1136270290_1136270296 -5 Left 1136270290 16:29144447-29144469 CCTCTCCCTGCTCGTGATTCACC No data
Right 1136270296 16:29144465-29144487 TCACCTATGGGGCTCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136270290 Original CRISPR GGTGAATCACGAGCAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr