ID: 1136271874

View in Genome Browser
Species Human (GRCh38)
Location 16:29153431-29153453
Sequence TAGGAAGTCCAGGAACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271874_1136271876 -10 Left 1136271874 16:29153431-29153453 CCTGTGTGTTCCTGGACTTCCTA No data
Right 1136271876 16:29153444-29153466 GGACTTCCTAACTCTAGTTCTGG No data
1136271874_1136271880 13 Left 1136271874 16:29153431-29153453 CCTGTGTGTTCCTGGACTTCCTA No data
Right 1136271880 16:29153467-29153489 AGACCAGAAGGGAAATCAAGAGG No data
1136271874_1136271879 2 Left 1136271874 16:29153431-29153453 CCTGTGTGTTCCTGGACTTCCTA No data
Right 1136271879 16:29153456-29153478 TCTAGTTCTGGAGACCAGAAGGG No data
1136271874_1136271878 1 Left 1136271874 16:29153431-29153453 CCTGTGTGTTCCTGGACTTCCTA No data
Right 1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271874 Original CRISPR TAGGAAGTCCAGGAACACAC AGG (reversed) Intergenic
No off target data available for this crispr