ID: 1136271878

View in Genome Browser
Species Human (GRCh38)
Location 16:29153455-29153477
Sequence CTCTAGTTCTGGAGACCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271875_1136271878 -9 Left 1136271875 16:29153441-29153463 CCTGGACTTCCTAACTCTAGTTC No data
Right 1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG No data
1136271873_1136271878 2 Left 1136271873 16:29153430-29153452 CCCTGTGTGTTCCTGGACTTCCT No data
Right 1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG No data
1136271872_1136271878 8 Left 1136271872 16:29153424-29153446 CCGGGGCCCTGTGTGTTCCTGGA No data
Right 1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG No data
1136271874_1136271878 1 Left 1136271874 16:29153431-29153453 CCTGTGTGTTCCTGGACTTCCTA No data
Right 1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271878 Original CRISPR CTCTAGTTCTGGAGACCAGA AGG Intergenic
No off target data available for this crispr