ID: 1136271894

View in Genome Browser
Species Human (GRCh38)
Location 16:29153525-29153547
Sequence CCTTCCAGCCGTACTCCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271882_1136271894 12 Left 1136271882 16:29153490-29153512 CCCGCCGAGCCATACTCCCTCCA No data
Right 1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG No data
1136271890_1136271894 -5 Left 1136271890 16:29153507-29153529 CCTCCAGAGGCTCTGGGCCCTTC No data
Right 1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG No data
1136271883_1136271894 11 Left 1136271883 16:29153491-29153513 CCGCCGAGCCATACTCCCTCCAG No data
Right 1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG No data
1136271889_1136271894 -4 Left 1136271889 16:29153506-29153528 CCCTCCAGAGGCTCTGGGCCCTT No data
Right 1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG No data
1136271891_1136271894 -8 Left 1136271891 16:29153510-29153532 CCAGAGGCTCTGGGCCCTTCCAG No data
Right 1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG No data
1136271886_1136271894 3 Left 1136271886 16:29153499-29153521 CCATACTCCCTCCAGAGGCTCTG No data
Right 1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG No data
1136271884_1136271894 8 Left 1136271884 16:29153494-29153516 CCGAGCCATACTCCCTCCAGAGG No data
Right 1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271894 Original CRISPR CCTTCCAGCCGTACTCCCTC CGG Intergenic
No off target data available for this crispr