ID: 1136271903

View in Genome Browser
Species Human (GRCh38)
Location 16:29153541-29153563
Sequence GAAGGGCCCAGAGCCCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271903_1136271913 4 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271913 16:29153568-29153590 CGTACTCCCTCTGGGGGCTCTGG No data
1136271903_1136271907 -5 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271903_1136271908 -4 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271908 16:29153560-29153582 CTTCCAGCCGTACTCCCTCTGGG No data
1136271903_1136271910 -2 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271910 16:29153562-29153584 TCCAGCCGTACTCCCTCTGGGGG No data
1136271903_1136271914 5 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271914 16:29153569-29153591 GTACTCCCTCTGGGGGCTCTGGG No data
1136271903_1136271909 -3 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271909 16:29153561-29153583 TTCCAGCCGTACTCCCTCTGGGG No data
1136271903_1136271918 29 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271903_1136271919 30 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271919 16:29153594-29153616 CTTCCAGCCGTACTCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271903 Original CRISPR GAAGGGCCCAGAGCCCCCGG AGG (reversed) Intergenic
No off target data available for this crispr