ID: 1136271907

View in Genome Browser
Species Human (GRCh38)
Location 16:29153559-29153581
Sequence CCTTCCAGCCGTACTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271902_1136271907 -4 Left 1136271902 16:29153540-29153562 CCCTCCGGGGGCTCTGGGCCCTT No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271892_1136271907 12 Left 1136271892 16:29153524-29153546 CCCTTCCAGCCGTACTCCCTCCG No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271891_1136271907 26 Left 1136271891 16:29153510-29153532 CCAGAGGCTCTGGGCCCTTCCAG No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271903_1136271907 -5 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271889_1136271907 30 Left 1136271889 16:29153506-29153528 CCCTCCAGAGGCTCTGGGCCCTT No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271904_1136271907 -8 Left 1136271904 16:29153544-29153566 CCGGGGGCTCTGGGCCCTTCCAG No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271893_1136271907 11 Left 1136271893 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271899_1136271907 3 Left 1136271899 16:29153533-29153555 CCGTACTCCCTCCGGGGGCTCTG No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271898_1136271907 7 Left 1136271898 16:29153529-29153551 CCAGCCGTACTCCCTCCGGGGGC No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
1136271890_1136271907 29 Left 1136271890 16:29153507-29153529 CCTCCAGAGGCTCTGGGCCCTTC No data
Right 1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271907 Original CRISPR CCTTCCAGCCGTACTCCCTC TGG Intergenic
No off target data available for this crispr