ID: 1136271918

View in Genome Browser
Species Human (GRCh38)
Location 16:29153593-29153615
Sequence CCTTCCAGCCGTACTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271911_1136271918 7 Left 1136271911 16:29153563-29153585 CCAGCCGTACTCCCTCTGGGGGC No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271902_1136271918 30 Left 1136271902 16:29153540-29153562 CCCTCCGGGGGCTCTGGGCCCTT No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271904_1136271918 26 Left 1136271904 16:29153544-29153566 CCGGGGGCTCTGGGCCCTTCCAG No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271905_1136271918 12 Left 1136271905 16:29153558-29153580 CCCTTCCAGCCGTACTCCCTCTG No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271903_1136271918 29 Left 1136271903 16:29153541-29153563 CCTCCGGGGGCTCTGGGCCCTTC No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271912_1136271918 3 Left 1136271912 16:29153567-29153589 CCGTACTCCCTCTGGGGGCTCTG No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271906_1136271918 11 Left 1136271906 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271916_1136271918 -5 Left 1136271916 16:29153575-29153597 CCTCTGGGGGCTCTGGGTCCTTC No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
1136271915_1136271918 -4 Left 1136271915 16:29153574-29153596 CCCTCTGGGGGCTCTGGGTCCTT No data
Right 1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271918 Original CRISPR CCTTCCAGCCGTACTCCCTC TGG Intergenic
No off target data available for this crispr