ID: 1136271929

View in Genome Browser
Species Human (GRCh38)
Location 16:29153627-29153649
Sequence CCTTCCAGCCGTACTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271922_1136271929 7 Left 1136271922 16:29153597-29153619 CCAGCCGTACTCCCTCTGGGGGC No data
Right 1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG No data
1136271916_1136271929 29 Left 1136271916 16:29153575-29153597 CCTCTGGGGGCTCTGGGTCCTTC No data
Right 1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG No data
1136271917_1136271929 11 Left 1136271917 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG No data
Right 1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG No data
1136271915_1136271929 30 Left 1136271915 16:29153574-29153596 CCCTCTGGGGGCTCTGGGTCCTT No data
Right 1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG No data
1136271923_1136271929 3 Left 1136271923 16:29153601-29153623 CCGTACTCCCTCTGGGGGCTCTG No data
Right 1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG No data
1136271927_1136271929 -5 Left 1136271927 16:29153609-29153631 CCTCTGGGGGCTCTGGGTCCTTC No data
Right 1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG No data
1136271926_1136271929 -4 Left 1136271926 16:29153608-29153630 CCCTCTGGGGGCTCTGGGTCCTT No data
Right 1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271929 Original CRISPR CCTTCCAGCCGTACTCCCTC TGG Intergenic
No off target data available for this crispr