ID: 1136271951

View in Genome Browser
Species Human (GRCh38)
Location 16:29153699-29153721
Sequence GCCTCCGGAGGGACTATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271951_1136271966 17 Left 1136271951 16:29153699-29153721 CCAGCCATAGTCCCTCCGGAGGC No data
Right 1136271966 16:29153739-29153761 GTACTCCCCCTGGGGGCTCTGGG No data
1136271951_1136271961 8 Left 1136271951 16:29153699-29153721 CCAGCCATAGTCCCTCCGGAGGC No data
Right 1136271961 16:29153730-29153752 CTTCCAGCTGTACTCCCCCTGGG No data
1136271951_1136271962 9 Left 1136271951 16:29153699-29153721 CCAGCCATAGTCCCTCCGGAGGC No data
Right 1136271962 16:29153731-29153753 TTCCAGCTGTACTCCCCCTGGGG No data
1136271951_1136271963 10 Left 1136271951 16:29153699-29153721 CCAGCCATAGTCCCTCCGGAGGC No data
Right 1136271963 16:29153732-29153754 TCCAGCTGTACTCCCCCTGGGGG No data
1136271951_1136271965 16 Left 1136271951 16:29153699-29153721 CCAGCCATAGTCCCTCCGGAGGC No data
Right 1136271965 16:29153738-29153760 TGTACTCCCCCTGGGGGCTCTGG No data
1136271951_1136271960 7 Left 1136271951 16:29153699-29153721 CCAGCCATAGTCCCTCCGGAGGC No data
Right 1136271960 16:29153729-29153751 CCTTCCAGCTGTACTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271951 Original CRISPR GCCTCCGGAGGGACTATGGC TGG (reversed) Intergenic
No off target data available for this crispr