ID: 1136271957

View in Genome Browser
Species Human (GRCh38)
Location 16:29153714-29153736
Sequence CTGGAAGGGCCCAGAGCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271957_1136271963 -5 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271963 16:29153732-29153754 TCCAGCTGTACTCCCCCTGGGGG No data
1136271957_1136271973 27 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271973 16:29153764-29153786 CTTCCAGCCGTACTCCCTCTGGG No data
1136271957_1136271960 -8 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271960 16:29153729-29153751 CCTTCCAGCTGTACTCCCCCTGG No data
1136271957_1136271961 -7 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271961 16:29153730-29153752 CTTCCAGCTGTACTCCCCCTGGG No data
1136271957_1136271974 28 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271974 16:29153765-29153787 TTCCAGCCGTACTCCCTCTGGGG No data
1136271957_1136271965 1 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271965 16:29153738-29153760 TGTACTCCCCCTGGGGGCTCTGG No data
1136271957_1136271972 26 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271957_1136271975 29 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271975 16:29153766-29153788 TCCAGCCGTACTCCCTCTGGGGG No data
1136271957_1136271966 2 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271966 16:29153739-29153761 GTACTCCCCCTGGGGGCTCTGGG No data
1136271957_1136271962 -6 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271962 16:29153731-29153753 TTCCAGCTGTACTCCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271957 Original CRISPR CTGGAAGGGCCCAGAGCCTC CGG (reversed) Intergenic
No off target data available for this crispr