ID: 1136271966

View in Genome Browser
Species Human (GRCh38)
Location 16:29153739-29153761
Sequence GTACTCCCCCTGGGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271957_1136271966 2 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271966 16:29153739-29153761 GTACTCCCCCTGGGGGCTCTGGG No data
1136271955_1136271966 6 Left 1136271955 16:29153710-29153732 CCCTCCGGAGGCTCTGGGCCCTT No data
Right 1136271966 16:29153739-29153761 GTACTCCCCCTGGGGGCTCTGGG No data
1136271952_1136271966 13 Left 1136271952 16:29153703-29153725 CCATAGTCCCTCCGGAGGCTCTG No data
Right 1136271966 16:29153739-29153761 GTACTCCCCCTGGGGGCTCTGGG No data
1136271956_1136271966 5 Left 1136271956 16:29153711-29153733 CCTCCGGAGGCTCTGGGCCCTTC No data
Right 1136271966 16:29153739-29153761 GTACTCCCCCTGGGGGCTCTGGG No data
1136271951_1136271966 17 Left 1136271951 16:29153699-29153721 CCAGCCATAGTCCCTCCGGAGGC No data
Right 1136271966 16:29153739-29153761 GTACTCCCCCTGGGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271966 Original CRISPR GTACTCCCCCTGGGGGCTCT GGG Intergenic
No off target data available for this crispr