ID: 1136271969

View in Genome Browser
Species Human (GRCh38)
Location 16:29153746-29153768
Sequence GGAAGGACCCAGAGCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271969_1136271979 4 Left 1136271969 16:29153746-29153768 CCCTGGGGGCTCTGGGTCCTTCC No data
Right 1136271979 16:29153773-29153795 GTACTCCCTCTGGGGGCTCTGGG No data
1136271969_1136271973 -5 Left 1136271969 16:29153746-29153768 CCCTGGGGGCTCTGGGTCCTTCC No data
Right 1136271973 16:29153764-29153786 CTTCCAGCCGTACTCCCTCTGGG No data
1136271969_1136271974 -4 Left 1136271969 16:29153746-29153768 CCCTGGGGGCTCTGGGTCCTTCC No data
Right 1136271974 16:29153765-29153787 TTCCAGCCGTACTCCCTCTGGGG No data
1136271969_1136271975 -3 Left 1136271969 16:29153746-29153768 CCCTGGGGGCTCTGGGTCCTTCC No data
Right 1136271975 16:29153766-29153788 TCCAGCCGTACTCCCTCTGGGGG No data
1136271969_1136271978 3 Left 1136271969 16:29153746-29153768 CCCTGGGGGCTCTGGGTCCTTCC No data
Right 1136271978 16:29153772-29153794 CGTACTCCCTCTGGGGGCTCTGG No data
1136271969_1136271972 -6 Left 1136271969 16:29153746-29153768 CCCTGGGGGCTCTGGGTCCTTCC No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271969 Original CRISPR GGAAGGACCCAGAGCCCCCA GGG (reversed) Intergenic
No off target data available for this crispr