ID: 1136271972

View in Genome Browser
Species Human (GRCh38)
Location 16:29153763-29153785
Sequence CCTTCCAGCCGTACTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136271956_1136271972 29 Left 1136271956 16:29153711-29153733 CCTCCGGAGGCTCTGGGCCCTTC No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271964_1136271972 7 Left 1136271964 16:29153733-29153755 CCAGCTGTACTCCCCCTGGGGGC No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271970_1136271972 -7 Left 1136271970 16:29153747-29153769 CCTGGGGGCTCTGGGTCCTTCCA No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271968_1136271972 -5 Left 1136271968 16:29153745-29153767 CCCCTGGGGGCTCTGGGTCCTTC No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271957_1136271972 26 Left 1136271957 16:29153714-29153736 CCGGAGGCTCTGGGCCCTTCCAG No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271967_1136271972 -4 Left 1136271967 16:29153744-29153766 CCCCCTGGGGGCTCTGGGTCCTT No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271958_1136271972 12 Left 1136271958 16:29153728-29153750 CCCTTCCAGCTGTACTCCCCCTG No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271959_1136271972 11 Left 1136271959 16:29153729-29153751 CCTTCCAGCTGTACTCCCCCTGG No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271969_1136271972 -6 Left 1136271969 16:29153746-29153768 CCCTGGGGGCTCTGGGTCCTTCC No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data
1136271955_1136271972 30 Left 1136271955 16:29153710-29153732 CCCTCCGGAGGCTCTGGGCCCTT No data
Right 1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136271972 Original CRISPR CCTTCCAGCCGTACTCCCTC TGG Intergenic
No off target data available for this crispr