ID: 1136272207

View in Genome Browser
Species Human (GRCh38)
Location 16:29155035-29155057
Sequence CGCGCGCGTGCACTCACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136272207_1136272211 28 Left 1136272207 16:29155035-29155057 CCTGAAGTGAGTGCACGCGCGCG No data
Right 1136272211 16:29155086-29155108 CAGAGCTACGAGAGTCTGAACGG No data
1136272207_1136272208 0 Left 1136272207 16:29155035-29155057 CCTGAAGTGAGTGCACGCGCGCG No data
Right 1136272208 16:29155058-29155080 CACACACACACACACACACCAGG 0: 243
1: 2580
2: 2533
3: 3966
4: 6713
1136272207_1136272209 1 Left 1136272207 16:29155035-29155057 CCTGAAGTGAGTGCACGCGCGCG No data
Right 1136272209 16:29155059-29155081 ACACACACACACACACACCAGGG 0: 313
1: 1223
2: 4102
3: 4347
4: 8394
1136272207_1136272212 29 Left 1136272207 16:29155035-29155057 CCTGAAGTGAGTGCACGCGCGCG No data
Right 1136272212 16:29155087-29155109 AGAGCTACGAGAGTCTGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136272207 Original CRISPR CGCGCGCGTGCACTCACTTC AGG (reversed) Intergenic
No off target data available for this crispr