ID: 1136274718

View in Genome Browser
Species Human (GRCh38)
Location 16:29172251-29172273
Sequence TGGTGGAATGCTCCGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136274718_1136274723 -8 Left 1136274718 16:29172251-29172273 CCCCATCACGGAGCATTCCACCA No data
Right 1136274723 16:29172266-29172288 TTCCACCACTCCCGGTCCAAGGG No data
1136274718_1136274731 25 Left 1136274718 16:29172251-29172273 CCCCATCACGGAGCATTCCACCA No data
Right 1136274731 16:29172299-29172321 TCACTCAGTGTCTGTGACGCTGG No data
1136274718_1136274722 -9 Left 1136274718 16:29172251-29172273 CCCCATCACGGAGCATTCCACCA No data
Right 1136274722 16:29172265-29172287 ATTCCACCACTCCCGGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136274718 Original CRISPR TGGTGGAATGCTCCGTGATG GGG (reversed) Intergenic
No off target data available for this crispr