ID: 1136276288

View in Genome Browser
Species Human (GRCh38)
Location 16:29181091-29181113
Sequence GGACGAGGCCACGGAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136276284_1136276288 -2 Left 1136276284 16:29181070-29181092 CCTTGGAAGAGGAAGGCAGAAGG No data
Right 1136276288 16:29181091-29181113 GGACGAGGCCACGGAGAGACTGG No data
1136276277_1136276288 23 Left 1136276277 16:29181045-29181067 CCCTGGATTCCCTGTCATCTCAA No data
Right 1136276288 16:29181091-29181113 GGACGAGGCCACGGAGAGACTGG No data
1136276278_1136276288 22 Left 1136276278 16:29181046-29181068 CCTGGATTCCCTGTCATCTCAAG No data
Right 1136276288 16:29181091-29181113 GGACGAGGCCACGGAGAGACTGG No data
1136276280_1136276288 14 Left 1136276280 16:29181054-29181076 CCCTGTCATCTCAAGTCCTTGGA No data
Right 1136276288 16:29181091-29181113 GGACGAGGCCACGGAGAGACTGG No data
1136276281_1136276288 13 Left 1136276281 16:29181055-29181077 CCTGTCATCTCAAGTCCTTGGAA No data
Right 1136276288 16:29181091-29181113 GGACGAGGCCACGGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136276288 Original CRISPR GGACGAGGCCACGGAGAGAC TGG Intergenic
No off target data available for this crispr