ID: 1136279480

View in Genome Browser
Species Human (GRCh38)
Location 16:29199553-29199575
Sequence ACTTTTAAGGTACAGTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136279476_1136279480 25 Left 1136279476 16:29199505-29199527 CCAATTTTTAAATCGTGGTAACA No data
Right 1136279480 16:29199553-29199575 ACTTTTAAGGTACAGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136279480 Original CRISPR ACTTTTAAGGTACAGTTTGG TGG Intergenic
No off target data available for this crispr