ID: 1136281201

View in Genome Browser
Species Human (GRCh38)
Location 16:29212422-29212444
Sequence CAGGCTATGAACGGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136281191_1136281201 12 Left 1136281191 16:29212387-29212409 CCTGAAGACCAGGAGGAGAGGAA 0: 1
1: 0
2: 5
3: 44
4: 396
Right 1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG No data
1136281190_1136281201 13 Left 1136281190 16:29212386-29212408 CCCTGAAGACCAGGAGGAGAGGA 0: 1
1: 0
2: 8
3: 38
4: 363
Right 1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG No data
1136281196_1136281201 4 Left 1136281196 16:29212395-29212417 CCAGGAGGAGAGGAAGGAGGGGA No data
Right 1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136281201 Original CRISPR CAGGCTATGAACGGGGCTGC AGG Intergenic
No off target data available for this crispr