ID: 1136281704

View in Genome Browser
Species Human (GRCh38)
Location 16:29217285-29217307
Sequence GTCGCGGGCGTTGCTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136281694_1136281704 15 Left 1136281694 16:29217247-29217269 CCACTGCCAGGTGCTGATGAAAA No data
Right 1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG No data
1136281695_1136281704 9 Left 1136281695 16:29217253-29217275 CCAGGTGCTGATGAAAATGCAGC 0: 1
1: 1
2: 3
3: 24
4: 225
Right 1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136281704 Original CRISPR GTCGCGGGCGTTGCTGGCGG GGG Intergenic
No off target data available for this crispr